Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

adding Paired-tag EM multimapping and csi index output #1482

Merged
merged 3 commits into from
Jan 21, 2025
Merged

adding Paired-tag EM multimapping and csi index output #1482

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
3 commits
Select commit Hold shift + click to select a range
0cf1ab7
added csi_index to atac
ekiernan Jan 21, 2025
671a2da
updated changelogs, wdl versions
ekiernan Jan 21, 2025
4e56e15
Updated pipeline_versions.txt with all pipeline version information
actions-user Jan 21, 2025
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
6 changes: 3 additions & 3 deletions pipeline_versions.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -27,12 +27,12 @@ BroadInternalImputation 1.1.14 2024-11-04
BroadInternalArrays 1.1.14 2024-11-04
BroadInternalRNAWithUMIs 1.0.36 2024-11-04
RNAWithUMIsPipeline 1.0.18 2024-11-04
Multiome 5.9.5 2025-01-13
Multiome 5.9.6 2025-01-21
MultiSampleSmartSeq2SingleNucleus 2.0.7 2025-01-13
BuildIndices 4.0.0 2025-01-17
SlideSeq 3.4.8 2025-01-13
PairedTag 1.9.1 2025-01-13
atac 2.5.4 2025-01-13
PairedTag 1.10.0 2025-01-21
atac 2.6.0 2025-01-21
scATAC 1.3.2 2023-08-03
snm3C 4.0.4 2024-08-06
Optimus 7.9.1 2025-01-13
Expand Down
5 changes: 3 additions & 2 deletions pipelines/skylab/atac/atac.changelog.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,7 +1,8 @@
# 2.5.4
2025-01-13 (Date of Last Commit)
# 2.6.0
2025-01-21 (Date of Last Commit)

* Added reference_gtf_file to the output h5ad unstructured metadata
* Added the fragment file CSI index as a workflow output

# 2.5.3
2024-11-22 (Date of Last Commit)
Expand Down
4 changes: 3 additions & 1 deletion pipelines/skylab/atac/atac.wdl
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -49,7 +49,7 @@ workflow ATAC {
String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
}

String pipeline_version = "2.5.4"
String pipeline_version = "2.6.0"

# Determine docker prefix based on cloud provider
String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
Expand Down Expand Up @@ -164,12 +164,14 @@ workflow ATAC {

File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
File fragment_file_index_atac = select_first([BB_fragment.fragment_file_index, CreateFragmentFile.fragment_file_index])
File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])

output {
File bam_aligned_output = bam_aligned_output_atac
File fragment_file = fragment_file_atac
File fragment_file_index = fragment_file_index_atac
File snap_metrics = snap_metrics_atac
File library_metrics_file = library_metrics
}
Expand Down
5 changes: 3 additions & 2 deletions pipelines/skylab/multiome/Multiome.changelog.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,8 +1,9 @@
# 5.9.5
2025-01-13 (Date of Last Commit)
# 5.9.6
2025-01-21 (Date of Last Commit)

* Added a boolean variable is_slidetags; default is false but it is set to true if the Slide-Tags pipeline is calling Optimus
* Added reference_gtf_file to the output h5ad unstructured metadata
* Added the ATAC fragment file CSI index as high-level ATAC workflow output; this does not impact the Multiome workflow as Multiome already produces the csi index from ATAC

# 5.9.4
2024-12-05 (Date of Last Commit)
Expand Down
2 changes: 1 addition & 1 deletion pipelines/skylab/multiome/Multiome.wdl
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -7,7 +7,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils

workflow Multiome {

String pipeline_version = "5.9.5"
String pipeline_version = "5.9.6"

input {
String cloud_provider
Expand Down
6 changes: 4 additions & 2 deletions pipelines/skylab/paired_tag/PairedTag.changelog.md
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,8 +1,10 @@
# 1.9.1
2025-01-13 (Date of Last Commit)
# 1.10.0
2025-01-21 (Date of Last Commit)

* Added a boolean variable is_slidetags; default is false, but set to true if Slide-Tags pipeline is calling Optimus
* Added reference_gtf_file to the output h5ad unstructured metadata
* Added the fragment file CSI index as workflow output
* Updated the default STARsolo multimapping parameter to the "EM" tehcnique

# 1.9.0
2024-12-05 (Date of Last Commit)
Expand Down
6 changes: 4 additions & 2 deletions pipelines/skylab/paired_tag/PairedTag.wdl
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils

workflow PairedTag {

String pipeline_version = "1.9.1"
String pipeline_version = "1.10.0"


input {
Expand All @@ -33,7 +33,7 @@ workflow PairedTag {
Boolean count_exons = false
File gex_whitelist = if cloud_provider == "gcp" then "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt" else "https://datasetpublicbroadref.blob.core.windows.net/dataset/RNA/resources/arc-v1/737K-arc-v1_gex.txt?sv=2020-04-08&si=prod&sr=c&sig=DQxmjB4D1lAfOW9AxIWbXwZx6ksbwjlNkixw597JnvQ%3D"

String? soloMultiMappers = "Uniform"
String? soloMultiMappers = "EM"
# ATAC inputs
# Array of input fastq files
Array[File] atac_r1_fastq
Expand Down Expand Up @@ -153,6 +153,7 @@ workflow PairedTag {
}

File atac_fragment_out = select_first([ParseBarcodes.atac_fragment_tsv,Atac_preindex.fragment_file])
File atac_fragment_index_out = select_first([ParseBarcodes.atac_fragment_tsv_tbi,Atac_preindex.fragment_file_index])
File atac_h5ad_out = select_first([ParseBarcodes.atac_h5ad_file, Atac_preindex.snap_metrics])

output {
Expand All @@ -164,6 +165,7 @@ workflow PairedTag {
File fragment_file_atac = atac_fragment_out
File snap_metrics_atac = atac_h5ad_out
File atac_library_final = Atac_preindex.library_metrics_file
File fragment_file_index_atac = atac_fragment_index_out

# optimus outputs
File genomic_reference_version_gex = Optimus.genomic_reference_version
Expand Down
Loading