A Python-based tool for simplified DNA analysis focused on medical applications, making it practical for doctors and healthcare providers to analyze genetic data in the context of various medical conditions..
This tool allows the analysis of DNA sequences to detect common disease-associated mutations, genetic risk factors, and drug metabolism profiles. It generates clinical reports and visual summaries to aid in healthcare decision-making. The tool is designed to provide healthcare professionals with actionable insights derived from DNA sequences.
Mutation Detection: Identifies common mutations associated with diseases like Breast Cancer, Cystic Fibrosis, and Lynch Syndrome.
Risk Factor Analysis: Assesses genetic risk for cardiovascular diseases, Type 2 diabetes, Alzheimer's, and more.
Drug Metabolism Profiling: Analyzes genes related to drug metabolism, including CYP2D6, CYP2C19, and TPMT.
Clinical Report Generation: Automatically compiles a clinical report with findings and recommendations.
Visualization: Generates plots to visualize detected mutations, risk levels, and drug metabolism profiles.
Prerequisites
Ensure Python 3.x is installed on your machine. The tool relies on the following Python packages:
Install the dependencies by running the following command:
pip install -r requirements.txt
Clone the repository:
git clone https://github.com/yourusername/Medical-DNA-Analyzer.git
Install dependencies:
pip install -r requirements.txt
Initialize the Analyzer
Create an instance of the MedicalDNAAnalyzer
class by providing a DNA sequence string:
from MedicalDNAAnalyzer import MedicalDNAAnalyzer
# Example DNA sequence
sequence = "ATGCGTGTAGCTAGCGTAAAGTCGGTAGCTAGCTGCTGTTACG"
analyzer = MedicalDNAAnalyzer(sequence)
Analyze the Sequence
Check for mutations:
mutations = analyzer.check_mutations()
print(mutations)
Analyze genetic risk factors:
risk_factors = analyzer.analyze_risk_factors()
print(risk_factors)
Analyze drug metabolism:
drug_metabolism = analyzer.check_drug_metabolism()
print(drug_metabolism)
Generate a clinical report:
report = analyzer.generate_clinical_report()
print(report)
Visualize the findings:
analyzer.visualize_findings()
Print clinical summary:
analyzer.print_clinical_summary()
# DNA sequence example
sequence = "ATGCGTGTAGCTAGCGTAAAGTCGGTAGCTAGCTGCTGTTACG"
# Initialize the analyzer
analyzer = MedicalDNAAnalyzer(sequence)
# Generate and print a clinical summary
analyzer.print_clinical_summary()
# Visualize the findings
analyzer.visualize_findings()
Clinical Report: A detailed report summarizing mutations, risk factors, and drug metabolism findings with actionable recommendations.
Visualizations: Graphical representations of detected mutations, risk levels, and metabolism profiles using Seaborn and Matplotlib.