Release 2.4.1 #524

andresferben · 2025-12-19T13:18:26Z

PR checklist

Changed

[#479] - Fix igenomes_base in nextflow_schema.
[#481] - Fix MIRTOP_STATS IndexError - Fix mirtop process execution when mirgenedb is used.
[#482] - Update documentation regarding MirgeneDB input files.
[#486] - Replace CSVTK_JOIN to improve processing in large amount of files.
[#493] - Fix [#488] - Fix runtime error that can occur when params.genome is set.
[#494] - Update help text for --fasta parameter.
[#498] - Fix bowtie_index channel when in dir format.
[#502] - Update BLAT.
[#507] - Fix mirgeneDB error in mirtop when the GFF used don't contain this keyword. Fix slack comments.
[#509] - Add codeowners.
[#513] - Update miRTop.
[#515] - Template update for nf-core/tools v3.3.1
[#518] - Template update for nf-core/tools v3.5.1
[#520] - Updated JSON schemas.
[#521] - Update nf-core modules and subworkflows.
[#522] - Refactor and simplify pipeline test suite.

…le parameters

Issue 477

Co-authored-by: Nicolás Schcolnicov <[email protected]>

Add docs mirtop

Replace `CSVTK_JOIN` to improve processing in large amount of files

Prepare for release 2.4.1

github-actions · 2025-12-19T13:20:26Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit d3f2131

+| ✅ 249 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   3 tests had warnings |!

Details

❗ Test warnings:

pipeline_todos - TODO string in nextflow.config: Update the field with the details of the contributors to your pipeline. New with Nextflow version 24.10.0
pipeline_todos - TODO string in README.md: Include a figure that guides the user through the major workflow steps. Many nf-core
pipeline_todos - TODO string in nextflow.config: Specify any additional parameters here

❔ Tests ignored:

nextflow_config - Config default ignored: params.fastp_known_mirna_adapters
nf_test_content - nf_test_content

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/nf-test.yml
files_exist - File found: .github/actions/get-shards/action.yml
files_exist - File found: .github/actions/nf-test/action.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-smrnaseq_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-smrnaseq_logo_light.png
files_exist - File found: docs/images/nf-core-smrnaseq_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: nf-test.config
files_exist - File found: tests/default.nf.test
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-smrnaseq_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowSmrnaseq.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedHeaders
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config manifest.version does not contain dev for release: 2.4.1
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.umitools_extract_method= string
nextflow_config - Config default value correct: params.umitools_method= dir
nextflow_config - Config default value correct: params.skip_umi_extract_before_dedup= true
nextflow_config - Config default value correct: params.mature= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa
nextflow_config - Config default value correct: params.hairpin= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.three_prime_adapter= AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
nextflow_config - Config default value correct: params.trim_fastq= true
nextflow_config - Config default value correct: params.fastp_min_length= 17
nextflow_config - Config default value correct: params.fastp_max_length= 100
nextflow_config - Config default value correct: params.min_trimmed_reads= 10
nextflow_config - Config default value correct: params.phred_offset= 33
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-smrnaseq_logo_light.png matches the template
files_unchanged - docs/images/nf-core-smrnaseq_logo_light.png matches the template
files_unchanged - docs/images/nf-core-smrnaseq_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_nf_test - '.github/workflows/nf-test.yml' is triggered on expected events
actions_nf_test - '.github/workflows/nf-test.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
readme - README nf-core template version badge found.
readme - README Zenodo placeholder was replaced with DOI.
pipeline_if_empty_null - No ifEmpty(null) strings found
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: template-version-comment.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: fix_linting.yml
actions_schema_validation - Workflow validation passed: nf-test.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
local_component_structure - local subworkflows directory structure is correct 'subworkflows/local/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
modules_config - conf/modules.config found and not ignored.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - CAT_FASTQ found in conf/modules.config and Nextflow scripts.
modules_config - FASTP_LENGTH_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - INDEX_GENOME found in conf/modules.config and Nextflow scripts.
modules_config - CLEAN_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - UMITOOLS_EXTRACT found in conf/modules.config and Nextflow scripts.
modules_config - MIRTRACE_QC found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - EDGER_QC found in conf/modules.config and Nextflow scripts.
modules_config - SEQCLUSTER_COLLAPSE found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - NFCORE_SMRNASEQ found in conf/modules.config and Nextflow scripts.
modules_config - MIRDEEP2_MAPPER found in conf/modules.config and Nextflow scripts.
modules_config - SEQKIT_REPLACE found in conf/modules.config and Nextflow scripts.
modules_config - SEQKIT_FQ2FA found in conf/modules.config and Nextflow scripts.
modules_config - MIRDEEP2_MIRDEEP2 found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.5.1
rocrate_readme_sync - RO-Crate descriptions are in sync with README.md.
version_consistency - Version tags are consistent: manifest.version = 2.4.1, nfcore_yml.version = 2.4.1
included_configs - Pipeline config includes custom configs.

Run details

nf-core/tools version 3.5.1
Run at 2025-12-23 21:03:10

…oaded in nf-test.yml

…ty image

Update UMI trimming docs before release

Version 25.04.2 fixes the conda --mkdir error

nschcolnicov and others added 30 commits October 15, 2024 16:06

remove value from schema

fc7d58b

added igrenomes_base

45e3a40

Merge pull request #479 from nf-core/remove_igenomes_base_from_schema

3b7df98

add species to gtf meta

e89826f

Update CHANGELOG, remove dumps, update error message for reference fi…

8e1846a

…le parameters

Minor fixes

c8ae4c6

Updated changelog

e32847c

Merge pull request #481 from nf-core/issue_477

4037e4c

Issue 477

update docs

8c64601

update changelog

b1513c6

fix changelog

d04cc55

Update docs/usage.md

181039a

Co-authored-by: Nicolás Schcolnicov <[email protected]>

Merge pull request #482 from atrigila/add_docs_mirtop

c06b188

Add docs mirtop

refactor: add pivot functions

4106d8e

refactor: add more resources to wider process

e093df4

refactor: add config to pivot modules

32b34a1

refactor: add pivot modules to mirna_quant

aa8f24b

fix: library names, output extension

d84f810

refactor: rename meta channel

6c21e4c

test: update tests succeeded size

33943b1

fix: add tsv instead of csv

955961a

test: update tests snapshots

6e67071

Template update for nf-core/tools version 3.1.0

662f468

docs: update changelog

eab8687

Merge pull request #486 from atrigila/csvtk_replace

411a499

Replace `CSVTK_JOIN` to improve processing in large amount of files

Remove redundant mitrace_species check

69ef3aa

Update CHANGELOG.md

fef066a

Merge remote-tracking branch 'upstream/dev'

ae3efff

Updata help text for --fasta parameter

02a2724

Update CHANGELOG.md

1e7e716

andresferben and others added 4 commits December 18, 2025 20:39

Prepare for release 2.4.1

86e2f39

These changes were included in the previous version

9c8ff98

Update snapshot

5f72bd2

Merge pull request #523 from andresferben/dev

2a9d5cd

Prepare for release 2.4.1

andresferben added this to the 2.4.1 milestone Dec 19, 2025

andresferben linked an issue Dec 19, 2025 that may be closed by this pull request

Make release #514

Open

andresferben and others added 20 commits December 22, 2025 14:45

Version 25.04.2 fixes the conda --mkdir error

d7e7d45

nf-core lint fails if the minimum version is different from the one l…

7663faf

…oaded in nf-test.yml

Bump minimum version on other files

3472edf

Update changelog

2ffa549

Temporarily enable conda tests on dev PRs

10818dc

Conda env versions need to match the versions in the Docker/Singulari…

931e484

…ty image

Fix more conda env versions

2f4b361

Add vroom to conda environment

cd4f828

Trying to get the right gplots version

86a0c07

Update conda packages

4be1562

These files appear to be unstable when running with conda/docker

a7f3b99

Singularity images need to be HTTPS, not ORAS

279ba86

Replace images in local modules with Seqera containers

66fa572

docs: update usage.md with UMI kit warning

bfba84f

docs: update changelog

e65829d

Update release date

3470e07

Update CHANGELOG.md

8d9af2a

Merge pull request #526 from nf-core/umi_trimming_docs

9988e32

Update UMI trimming docs before release

Merge branch 'dev' into dev

a7676cf

Merge pull request #525 from andresferben/dev

d3f2131

Version 25.04.2 fixes the conda --mkdir error

andresferben marked this pull request as ready for review December 23, 2025 21:36

andresferben requested review from apeltzer and grst December 23, 2025 22:00

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Uh oh!

Release 2.4.1 #524

Release 2.4.1 #524

Uh oh!

andresferben commented Dec 19, 2025 •

edited

Loading

Uh oh!

github-actions bot commented Dec 19, 2025 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

10 participants

Release 2.4.1 #524

Are you sure you want to change the base?

Release 2.4.1 #524

Uh oh!

Conversation

andresferben commented Dec 19, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

PR checklist

Changed

Uh oh!

github-actions bot commented Dec 19, 2025 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

10 participants

andresferben commented Dec 19, 2025 •

edited

Loading

github-actions bot commented Dec 19, 2025 •

edited

Loading

`nf-core pipelines lint` overall result: Passed ✅ ⚠️