-
Notifications
You must be signed in to change notification settings - Fork 5
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge branch 'master' of github.com:mskcc/beagle into hotfix/v2_nucle…
…o_agg
- Loading branch information
Showing
18 changed files
with
2,585 additions
and
3 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
146 changes: 146 additions & 0 deletions
146
fixtures/tests/10075_D_single_TN_pair.argos_bam_1_0_0.input.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,146 @@ | ||
[ | ||
{ | ||
"assay": "IMPACT468_BAITS", | ||
"pi": "John Smith", | ||
"pi_email": "[email protected]", | ||
"patient_id": "C-8VK0V7", | ||
"genome": "GRCh37", | ||
"intervals": [ | ||
"1", | ||
"2", | ||
"3", | ||
"4", | ||
"5", | ||
"6", | ||
"7", | ||
"8", | ||
"9", | ||
"10", | ||
"11", | ||
"12", | ||
"13", | ||
"14", | ||
"15", | ||
"16", | ||
"17", | ||
"18", | ||
"19", | ||
"20", | ||
"21", | ||
"22", | ||
"X", | ||
"Y", | ||
"MT" | ||
], | ||
"opt_dup_pix_dist": "2500", | ||
"hapmap": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf" | ||
}, | ||
"dbsnp": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf" | ||
}, | ||
"indels_1000g": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf" | ||
}, | ||
"snps_1000g": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf" | ||
}, | ||
"covariates": [ | ||
"CycleCovariate", | ||
"ContextCovariate", | ||
"ReadGroupCovariate", | ||
"QualityScoreCovariate" | ||
], | ||
"abra_ram_min": 84000, | ||
"gatk_jar_path": "/usr/bin/gatk.jar", | ||
"bait_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/picard_baits.interval_list" | ||
}, | ||
"target_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/picard_targets.interval_list" | ||
}, | ||
"fp_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/FP_tiling_intervals.list" | ||
}, | ||
"ref_fasta": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta" | ||
}, | ||
"mouse_fasta": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta" | ||
}, | ||
"conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed", | ||
"tumor": { | ||
"ID": "s_C_8VK0V7_R001_d", | ||
"CN": "MSKCC", | ||
"LB": "10075_D_5_1_1_1", | ||
"PL": "Illumina", | ||
"PU": [ | ||
"HFTCNBBXY_GTATTGGC-TTGTCGGT" | ||
], | ||
"R1": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0439_BHFTCNBBXY/Project_10075_D/Sample_SK_MEL_1091A_T_IGO_10075_D_5/SK_MEL_1091A_T_IGO_10075_D_5_S80_R1_001.fastq.gz" | ||
} | ||
], | ||
"R2": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0439_BHFTCNBBXY/Project_10075_D/Sample_SK_MEL_1091A_T_IGO_10075_D_5/SK_MEL_1091A_T_IGO_10075_D_5_S80_R2_001.fastq.gz" | ||
} | ||
], | ||
"zR1": [], | ||
"zR2": [], | ||
"bam": [], | ||
"RG_ID": [ | ||
"s_C_8VK0V7_R001_d_HFTCNBBXY_GTATTGGC-TTGTCGGT" | ||
], | ||
"adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", | ||
"adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", | ||
"bwa_output": "s_C_8VK0V7_R001_d.bam", | ||
"request_id": "10075_D", | ||
"specimen_type": "Resection" | ||
}, | ||
"normal": { | ||
"ID": "s_C_8VK0V7_N001_d", | ||
"CN": "MSKCC", | ||
"LB": "10075_D_3", | ||
"PL": "Illumina", | ||
"PU": [ | ||
"HCYYWBBXY" | ||
], | ||
"R1": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/JAX_0397_BHCYYWBBXY/Project_10075_D/Sample_JW_MEL_007_NORM_IGO_10075_D_3/JW_MEL_007_NORM_IGO_10075_D_3_S15_R1_001.fastq.gz" | ||
} | ||
], | ||
"R2": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/JAX_0397_BHCYYWBBXY/Project_10075_D/Sample_JW_MEL_007_NORM_IGO_10075_D_3/JW_MEL_007_NORM_IGO_10075_D_3_S15_R2_001.fastq.gz" | ||
} | ||
], | ||
"zR1": [], | ||
"zR2": [], | ||
"bam": [], | ||
"RG_ID": [ | ||
"s_C_8VK0V7_N001_d_HCYYWBBXY" | ||
], | ||
"adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", | ||
"adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", | ||
"bwa_output": "s_C_8VK0V7_N001_d.bam", | ||
"request_id": "10075_D", | ||
"specimen_type": "Normal" | ||
} | ||
} | ||
] |
Oops, something went wrong.