VGP 4 - update tools and add Hi-C read trimming option (replace broken PR 507)

[Delphine-L]

Replace PR #507

[github-actions]

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	1
Failure	0
Skipped	0

Errored Tests

• ❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0

  Execution Problem:

  • Final state of invocation af17684a17d52602 is [failed]. Failed to run workflow, at least one job is in [error] state.
    

  Workflow invocation details

  • Invocation Messages

    • Invocation scheduling failed because step 7 requires a dataset created by step 6, but dataset entered a failed state.
  • Steps

    • Step 1: Pacbio Reads:

      • step_state: scheduled

    • Step 2: Trim Hi-C reads?:

      • step_state: scheduled

    • Step 11: Bits for bloom filter:

      • step_state: scheduled

    • Step 12: SAK input file:

      • step_state: scheduled

    • Step 13: Homozygous Read Coverage:

      • step_state: scheduled

    • Step 14: Genomescope Model Parameters:

      • step_state: scheduled

    • Step 15: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • ln -f -s '/tmp/tmpf7lqdm2z/files/a/f/7/dataset_af7d5a16-f039-457c-a351-7bb49a0d0d93.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 0, "input_1": {"values": [{"id": 3, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
            other_trimming_options	{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	["report", "json_stats"]
            read_mod_options	{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}

    • Step 16: __SORTLIST__:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            input	{"values": [{"id": 1, "src": "hdca"}]}
            sort_type	{"__current_case__": 0, "sort_type": "alpha"}

    • Step 17: __SORTLIST__:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            input	{"values": [{"id": 2, "src": "hdca"}]}
            sort_type	{"__current_case__": 0, "sort_type": "alpha"}

    • Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpf7lqdm2z/files/4/7/e/dataset_47e6cd31-5704-493e-9372-8c092a18dade.dat' > '/tmp/tmpf7lqdm2z/job_working_directory/000/10/outputs/dataset_ada89607-a8ca-45a0-a5f4-3b51342f82b5.dat'

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            case_sensitive	"-i"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            color	"NOCOLOR"
            dbkey	"?"
            invert	""
            lines_after	"0"
            lines_before	"0"
            regex_type	"-G"
            url_paste	"Haploid"

    • Step 19: pick_value:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"data"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}}

    • Step 20: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpf7lqdm2z/job_working_directory/000/12/configs/tmpkt58nba1' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpf7lqdm2z/files/1/2/3/dataset_1236e9f2-0c01-4385-900b-fb7f25644a8e.dat' '/tmp/tmpf7lqdm2z/job_working_directory/000/12/outputs/dataset_f1f5b9c3-d1e1-4065-9141-1a2a9974006c.dat'

          Exit Code:

          • 0

          Standard Output:

          • c3*2
            Computing 1 new columns with instructions ['c3*2;;']
            Computed new column values for 100.00% of 1 lines written.
            

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            avoid_scientific_notation	false
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            error_handling	{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}
            ops	{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}

    • Step 3: Hi-C Forward reads:

      • step_state: scheduled

    • Step 21: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is running

          Command Line:

          • die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpf7lqdm2z/files/8/b/d/dataset_8bd6163f-c0b0-49f9-8b4e-806520f4a587.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            comment	""
            dbkey	"?"
            export	false
            flat	false
            results	[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}]
            saveLog	"false"
            title	""

    • Step 22: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is skipped

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adapter_options	{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_options	{"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}
            library	{"__current_case__": 1, "input_1": {"values": [{"id": 7, "src": "dce"}]}, "input_2": {"values": [{"id": 8, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired"}
            other_trimming_options	{"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}
            output_selector	None
            read_mod_options	{"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false}

    • Step 23: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpf7lqdm2z/files/a/d/a/dataset_ada89607-a8ca-45a0-a5f4-3b51342f82b5.dat' > '/tmp/tmpf7lqdm2z/job_working_directory/000/15/outputs/dataset_979d494e-6d64-4ba9-8a2c-93fd01d6f76a.dat'

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            replacements	[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]

    • Step 24: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • perl '/tmp/tmpf7lqdm2z/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpf7lqdm2z/files/f/1/f/dataset_f1f5b9c3-d1e1-4065-9141-1a2a9974006c.dat' 'c7' T '/tmp/tmpf7lqdm2z/job_working_directory/000/16/outputs/dataset_903fa3b2-b970-44b3-8e78-27e651b594d6.dat'

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c7"
            dbkey	"?"
            delimiter	"T"

    • Step 25: Pick forward reads:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 9, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 7, "src": "dce"}]}}]}}

    • Step 26: Pick reverse reads:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 10, "src": "dce"}]}}, {"__index__": 1, "value": {"values": [{"id": 8, "src": "dce"}]}}]}}

    • Step 27: Convert characters1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • python /tmp/tmpf7lqdm2z/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpf7lqdm2z/files/9/7/9/dataset_979d494e-6d64-4ba9-8a2c-93fd01d6f76a.dat s /tmp/tmpf7lqdm2z/job_working_directory/000/19/outputs/dataset_98b68bc6-92a4-4a12-a522-d69e7cb4e9fb.dat

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"txt"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            condense	true
            convert_from	"s"
            dbkey	"?"
            strip	true

    • Step 28: Estimated homozygous read coverage:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 29: Hi-C Forward Reads:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is error

          Command Line:

          • (   cat "/tmp/tmpf7lqdm2z/files/a/6/f/dataset_a6fbe3d4-e3cd-4856-a897-ab4950f75673.dat" ;   ) > /tmp/tmpf7lqdm2z/job_working_directory/000/21/outputs/dataset_a8e71a51-8133-4b54-b6a4-916659428e21.dat

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filename	{"__current_case__": 1, "add_name": false}
            one_header	false

    • Step 30: Hi-C Reverse Reads:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is error

          Command Line:

          • (   cat "/tmp/tmpf7lqdm2z/files/e/1/a/dataset_e1a6d776-6870-49fc-8a22-e2e4edfb11ea.dat" ;   ) > /tmp/tmpf7lqdm2z/job_working_directory/000/22/outputs/dataset_25031e1a-3421-4632-ba98-71aa4da873dd.dat

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filename	{"__current_case__": 1, "add_name": false}
            one_header	false

    • Step 4: Hi-C Reverse reads:

      • step_state: scheduled

    • Step 31: Cut1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • perl '/tmp/tmpf7lqdm2z/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpf7lqdm2z/files/9/8/b/dataset_98b68bc6-92a4-4a12-a522-d69e7cb4e9fb.dat' 'c3' T '/tmp/tmpf7lqdm2z/job_working_directory/000/23/outputs/dataset_100450f9-a90e-46c2-a7f1-946410015331.dat'

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            columnList	"c3"
            dbkey	"?"
            delimiter	"T"

    • Step 32: Homozygous read coverage for Hifiasm:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            style_cond	{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}

    • Step 33: Estimated genome size:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is ok

          Command Line:

          • cd ../; python _evaluate_expression_.py

          Exit Code:

          • 0

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            param_type	"integer"
            remove_newlines	true

    • Step 34: Hifiasm:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"fastq.gz"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            advanced_options	{"__current_case__": 0, "advanced_selector": "blank"}
            assembly_options	{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}
            bins_out	false
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            filter_bits	"32"
            hic_partition	{"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 25, "src": "hda"}]}, "h2": {"values": [{"id": 26, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null}
            log_out	true
            mode	{"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 4, "src": "hdca"}]}}
            ont_integration	{"__current_case__": 0, "ont_integration_selector": "blank"}
            purge_options	{"__current_case__": 0, "purge_selector": "blank"}
            scaffolding_options	{"__current_case__": 0, "scaffold_selector": "blank"}

    • Step 35: Raw Unitig Image:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            fontsize	None
            height	"2000"
            lengths	false
            names	false
            nodewidth	"25.0"
            output_format	"png"
            width	None

    • Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 38: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 39: gfastats gfa hap2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 5: Genomescope Summary:

      • step_state: scheduled

    • Step 41: gfastats gfa hap1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 42: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            mode_condition	{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}
            target_condition	{"__current_case__": 0, "target_option": "false"}

    • Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            code	"BEGIN{print \"Metric\\thap2\"}; {print}; "
            dbkey	"?"

    • Step 45: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            code	"BEGIN{print \"Metric\\thap1\"}; {print}; "
            dbkey	"?"

    • Step 46: Data Prep Hap2:

      • step_state: new

      • Subworkflow Steps

        • Step 1: gfa_stats:

          • step_state: scheduled

        • Step 2: sort1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"tabular"
                __workflow_invocation_uuid__	"fd83c0e3b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                column	"2"
                column_set	[]
                dbkey	"?"
                header_lines	"0"
                order	"DESC"
                style	"num"

        • Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e3b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                code	"{total += $2; $3 = total}1"
                dbkey	"?"

        • Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e3b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                grouping	""
                header_in	false
                header_out	false
                ignore_case	false
                narm	false
                need_sort	false
                operations	[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]
                print_full_line	false

        • Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e3b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                exp	"1"
                iterate	"yes"

        • Step 6: param_value_from_file:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"tabular"
                __workflow_invocation_uuid__	"fd83c0e3b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                param_type	"integer"
                remove_newlines	true

        • Step 7: Unlabelled step:

          • step_state: new

        • Step 8: Unlabelled step:

          • step_state: new

    • Step 47: Data Prep Hap1:

      • step_state: new

      • Subworkflow Steps

        • Step 1: gfa_stats:

          • step_state: scheduled

        • Step 2: sort1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"tabular"
                __workflow_invocation_uuid__	"fd83c0e4b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                column	"2"
                column_set	[]
                dbkey	"?"
                header_lines	"0"
                order	"DESC"
                style	"num"

        • Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e4b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                code	"{total += $2; $3 = total}1"
                dbkey	"?"

        • Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e4b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                grouping	""
                header_in	false
                header_out	false
                ignore_case	false
                narm	false
                need_sort	false
                operations	[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]
                print_full_line	false

        • Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"input"
                __workflow_invocation_uuid__	"fd83c0e4b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                exp	"1"
                iterate	"yes"

        • Step 6: param_value_from_file:

          • step_state: scheduled

          • Jobs

            • Job 1:

              • Job state is paused

              Traceback:

              Job Parameters:

              • Job parameter	Parameter value
                __input_ext	"tabular"
                __workflow_invocation_uuid__	"fd83c0e4b99411ef899e000d3a59a838"
                chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
                dbkey	"?"
                param_type	"integer"
                remove_newlines	true

        • Step 7: Unlabelled step:

          • step_state: new

        • Step 8: Unlabelled step:

          • step_state: new

    • Step 48: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adv_opts	{"__current_case__": 0, "adv_opts_selector": "basic"}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            code	"s/_path//g"
            dbkey	"?"

    • Step 49: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_sed_tool/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adv_opts	{"__current_case__": 0, "adv_opts_selector": "basic"}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            code	"s/_path//g"
            dbkey	"?"

    • Step 50: join1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"tabular"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            field1	"1"
            field2	"1"
            fill_empty_columns	{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}
            header	""
            partial	"-p"
            unmatched	"-u"

    • Step 6: Meryl Database:

      • step_state: scheduled

    • Step 51: Plot Data:

      • step_state: new

      • Subworkflow Steps

    • Step 52: Busco Hap2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adv	{"contig_break": "10", "evalue": "0.001", "limit": "3"}
            busco_mode	{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "metaeuk"}}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            lineage	{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}
            lineage_conditional	{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}
            outputs	["short_summary", "missing", "image", "gff"]

    • Step 53: Merqury:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            label	"output_merqury"
            mode	{"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 58, "src": "hda"}]}, "assembly_02": {"values": [{"id": 57, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"}
            output_add_headers	true
            output_selector	["qv", "plots", "stats", "log", "hist"]

    • Step 54: Busco Hap1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            adv	{"contig_break": "10", "evalue": "0.001", "limit": "3"}
            busco_mode	{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "metaeuk"}}
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            lineage	{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}
            lineage_conditional	{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}
            outputs	["short_summary", "missing", "image", "gff"]

    • Step 55: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            complement	"--complement"
            cut_type_options	{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}
            dbkey	"?"

    • Step 56: output_merqury.spectra-cn.fl:

      • step_state: new

    • Step 57: output_merqury.spectra-asm.fl:

      • step_state: new

    • Step 58: merqury_qv:

      • step_state: new

    • Step 59: output_merqury.assembly_01.spectra-cn.fl:

      • step_state: new

    • Step 60: merqury_stats:

      • step_state: new

    • Step 7: Database for Busco Lineage:

      • step_state: scheduled

    • Step 61: output_merqury.assembly_02.spectra-cn.fl:

      • step_state: new

    • Step 62: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

      • step_state: scheduled

      • Jobs

        • Job 1:

          • Job state is paused

          Traceback:

          Job Parameters:

          • Job parameter	Parameter value
            __input_ext	"input"
            __workflow_invocation_uuid__	"fd83c0e2b99411ef899e000d3a59a838"
            chromInfo	"/tmp/tmpf7lqdm2z/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"
            dbkey	"?"
            find_and_replace	[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]

    • Step 8: Lineage:

      • step_state: scheduled

    • Step 9: Name for Haplotype 1:

      • step_state: scheduled

    • Step 10: Name for Haplotype 2:

      • step_state: scheduled
  • Other invocation details

    • error_message

      • Final state of invocation af17684a17d52602 is [failed]. Failed to run workflow, at least one job is in [error] state.

    • history_id

      • af17684a17d52602

    • history_state

      • error

    • invocation_id

      • af17684a17d52602

    • invocation_state

      • failed

    • messages

      • [{'dependent_workflow_step_id': 5, 'hda_id': '87f6d1ac43807461', 'reason': 'dataset_failed', 'workflow_step_id': 6}]

    • workflow_id

      • 9dc5fe5ff756e79b

[Delphine-L]

@mvdbeek I think that is the same issue that for workflow 8 caused by galaxyproject/galaxy#19245 . The Steps 29 and 30 are the concatenate jobs in error. Test work ok against main, but fail against vgp instance.