Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 #624

gxydevbot · 2024-12-09T04:20:08Z

Hello! This is an automated update of the following workflow: workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0
toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0
toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0 should be updated to toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0

The workflow release number has been updated from 0.2.2 to 0.2.3.

If you want to skip this change, close this PR without deleting the branch. It will be reopened if another change is detected.
Any commit from another author than 'planemo-autoupdate' will prevent more auto-updates.
To ignore manual changes and allow autoupdates, delete the branch.

github-actions · 2024-12-09T04:57:17Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-only-VGP3.ga_0

Problems:

Output with path /tmp/tmpi5uqwd70/Hifiasm Primary assembly__824a6743-a59d-4a06-b029-d834bbc4a4f1 different than expected
Expected 170+-0 lines in the output found 168

Output with path /tmp/tmpbj1619ml/Hifiasm Alternate assembly__073d3996-2586-4d46-8627-a5128f5306b4 different than expected
Expected 2+-0 lines in the output found 6

Output with path /tmp/tmpnvjb3c00/gfastats on data 28 stats__299744a3-fcd5-4977-97ec-eedb63de8bd0 different than expected
Expected line '# scaffolds	1' in output ('Expected genome size	2,288,021
# scaffolds	3
Total scaffold length	34,014
Average scaffold length	11,338.00
Scaffold N50	11,612
Scaffold auN	11,441.29
Scaffold L50	2
Scaffold NG50	0
Scaffold auNG	170.09
Scaffold LG50	0
Largest scaffold	12,505
Smallest scaffold	9,897
# contigs	3
Total contig length	34,014
Average contig length	11,338.00
Contig N50	11,612
Contig auN	11,441.29
Contig L50	2
Contig NG50	0
Contig auNG	170.09
Contig LG50	0
Largest contig	12,505
Smallest contig	9,897
# gaps in scaffolds	0
Total gap length in scaffolds	0
Average gap length in scaffolds	0.00
Gap N50 in scaffolds	0
Gap auN in scaffolds	0.00
Gap L50 in scaffolds	0
Largest gap in scaffolds	0
Smallest gap in scaffolds	0
Base composition (A:C:G:T)	9,774:7,208:7,720:9,312
GC content %	43.89
# soft-masked bases	0
# segments	3
Total segment length	34,014
Average segment length	11,338.00
# gaps	0
# paths	3
# edges	4
Average degree	1.33
# connected components	1
Largest connected component length	34,014
# dead ends	3
# disconnected components	0
Total length disconnected components	0
# separated components	1
# bubbles	0
# circular segments	0
# circular paths	0
Scaffold N10	12,505
Scaffold N20	12,505
Scaffold N30	12,505
Scaffold N40	11,612
Scaffold N50	11,612
Scaffold N60	11,612
Scaffold N70	11,612
Scaffold N80	9,897
Scaffold N90	9,897
Scaffold N100	9,897
Scaffold L10	1
Scaffold L20	1
Scaffold L30	1
Scaffold L40	2
Scaffold L50	2
Scaffold L60	2
Scaffold L70	2
Scaffold L80	3
Scaffold L90	3
Scaffold L100	3
Scaffold NG10	0
Scaffold NG20	0
Scaffold NG30	0
Scaffold NG40	0
Scaffold NG50	0
Scaffold NG60	0
Scaffold NG70	0
Scaffold NG80	0
Scaffold NG90	0
Scaffold NG100	0
Scaffold LG10	0
Scaffold LG20	0
Scaffold LG30	0
Scaffold LG40	0
Scaffold LG50	0
Scaffold LG60	0
Scaffold LG70	0
Scaffold LG80	0
Scaffold LG90	0
Scaffold LG100	0
Contig N10	12,505
Contig N20	12,505
Contig N30	12,505
Contig N40	11,612
Contig N50	11,612
Contig N60	11,612
Contig N70	11,612
Contig N80	9,897
Contig N90	9,897
Contig N100	9,897
Contig L10	1
Contig L20	1
Contig L30	1
Contig L40	2
Contig L50	2
Contig L60	2
Contig L70	2
Contig L80	3
Contig L90	3
Contig L100	3
Contig NG10	0
Contig NG20	0
Contig NG30	0
Contig NG40	0
Contig NG50	0
Contig NG60	0
Contig NG70	0
Contig NG80	0
Contig NG90	0
Contig NG100	0
Contig LG10	0
Contig LG20	0
Contig LG30	0
Contig LG40	0
Contig LG50	0
Contig LG60	0
Contig LG70	0
Contig LG80	0
Contig LG90	0
Contig LG100	0
Gap N10	0
Gap N20	0
Gap N30	0
Gap N40	0
Gap N50	0
Gap N60	0
Gap N70	0
Gap N80	0
Gap N90	0
Gap N100	0
Gap L10	0
Gap L20	0
Gap L30	0
Gap L40	0
Gap L50	0
Gap L60	0
Gap L70	0
Gap L80	0
Gap L90	0
Gap L100	0
')

Output with path /tmp/tmpxoi27t97/gfastats on data 27 stats__b28c56cd-ab70-40e0-ba0c-0bd5c65b677a different than expected
Expected line '# scaffolds	85' in output ('Expected genome size	2,288,021
# scaffolds	84
Total scaffold length	2,052,441
Average scaffold length	24,433.82
Scaffold N50	22,011
Scaffold auN	34,199.59
Scaffold L50	31
Scaffold NG50	20,895
Scaffold auNG	30,678.32
Scaffold LG50	36
Largest scaffold	132,684
Smallest scaffold	15,406
# contigs	84
Total contig length	2,052,441
Average contig length	24,433.82
Contig N50	22,011
Contig auN	34,199.59
Contig L50	31
Contig NG50	20,895
Contig auNG	30,678.32
Contig LG50	36
Largest contig	132,684
Smallest contig	15,406
# gaps in scaffolds	0
Total gap length in scaffolds	0
Average gap length in scaffolds	0.00
Gap N50 in scaffolds	0
Gap auN in scaffolds	0.00
Gap L50 in scaffolds	0
Largest gap in scaffolds	0
Smallest gap in scaffolds	0
Base composition (A:C:G:T)	627,800:397,884:399,253:627,504
GC content %	38.84
# soft-masked bases	0
# segments	84
Total segment length	2,052,441
Average segment length	24,433.82
# gaps	0
# paths	84
# edges	8
Average degree	0.10
# connected components	2
Largest connected component length	96,664
# dead ends	162
# disconnected components	78
Total length disconnected components	1,895,760
# separated components	80
# bubbles	0
# circular segments	0
# circular paths	0
Scaffold N10	93,875
Scaffold N20	38,474
Scaffold N30	26,760
Scaffold N40	24,256
Scaffold N50	22,011
Scaffold N60	20,526
Scaffold N70	19,727
Scaffold N80	19,045
Scaffold N90	17,730
Scaffold N100	15,406
Scaffold L10	2
Scaffold L20	7
Scaffold L30	14
Scaffold L40	22
Scaffold L50	31
Scaffold L60	40
Scaffold L70	51
Scaffold L80	61
Scaffold L90	72
Scaffold L100	84
Scaffold NG10	46,449
Scaffold NG20	31,085
Scaffold NG30	25,225
Scaffold NG40	23,513
Scaffold NG50	20,895
Scaffold NG60	19,871
Scaffold NG70	19,102
Scaffold NG80	17,885
Scaffold NG90	0
Scaffold NG100	0
Scaffold LG10	3
Scaffold LG20	8
Scaffold LG30	16
Scaffold LG40	26
Scaffold LG50	36
Scaffold LG60	47
Scaffold LG70	59
Scaffold LG80	71
Scaffold LG90	0
Scaffold LG100	0
Contig N10	93,875
Contig N20	38,474
Contig N30	26,760
Contig N40	24,256
Contig N50	22,011
Contig N60	20,526
Contig N70	19,727
Contig N80	19,045
Contig N90	17,730
Contig N100	15,406
Contig L10	2
Contig L20	7
Contig L30	14
Contig L40	22
Contig L50	31
Contig L60	40
Contig L70	51
Contig L80	61
Contig L90	72
Contig L100	84
Contig NG10	46,449
Contig NG20	31,085
Contig NG30	25,225
Contig NG40	23,513
Contig NG50	20,895
Contig NG60	19,871
Contig NG70	19,102
Contig NG80	17,885
Contig NG90	0
Contig NG100	0
Contig LG10	3
Contig LG20	8
Contig LG30	16
Contig LG40	26
Contig LG50	36
Contig LG60	47
Contig LG70	59
Contig LG80	71
Contig LG90	0
Contig LG100	0
Gap N10	0
Gap N20	0
Gap N30	0
Gap N40	0
Gap N50	0
Gap N60	0
Gap N70	0
Gap N80	0
Gap N90	0
Gap N100	0
Gap L10	0
Gap L20	0
Gap L30	0
Gap L40	0
Gap L50	0
Gap L60	0
Gap L70	0
Gap L80	0
Gap L90	0
Gap L100	0
')

Output with path /tmp/tmpm7_5sjix/Assembly statistics__12844d87-15ff-418d-a9b0-15a753c4178d different than expected
Expected line '# scaffolds	85	1' in output ('Metric	Primary	Alternate
Expected genome size	2,288,021	2,288,021
# scaffolds	84	3
Total scaffold length	2,052,441	34,014
Average scaffold length	24,433.82	11,338.00
Scaffold N50	22,011	11,612
Scaffold N50	22,011	11,612
Scaffold auN	34,199.59	11,441.29
Scaffold L50	31	2
Scaffold L50	31	2
Scaffold NG50	20,895	0
Scaffold NG50	20,895	0
Scaffold auNG	30,678.32	170.09
Scaffold LG50	36	0
Scaffold LG50	36	0
Largest scaffold	132,684	12,505
Smallest scaffold	15,406	9,897
# contigs	84	3
Total contig length	2,052,441	34,014
Average contig length	24,433.82	11,338.00
Contig N50	22,011	11,612
Contig N50	22,011	11,612
Contig auN	34,199.59	11,441.29
Contig L50	31	2
Contig L50	31	2
Contig NG50	20,895	0
Contig NG50	20,895	0
Contig auNG	30,678.32	170.09
Contig LG50	36	0
Contig LG50	36	0
Largest contig	132,684	12,505
Smallest contig	15,406	9,897
# gaps in scaffolds	0	0
Total gap length in scaffolds	0	0
Average gap length in scaffolds	0.00	0.00
Gap N50 in scaffolds	0	0
Gap auN in scaffolds	0.00	0.00
Gap L50 in scaffolds	0	0
Largest gap in scaffolds	0	0
Smallest gap in scaffolds	0	0
Base composition (A:C:G:T)	627,800:397,884:399,253:627,504	9,774:7,208:7,720:9,312
GC content %	38.84	43.89
# soft-masked bases	0	0
# segments	84	3
Total segment length	2,052,441	34,014
Average segment length	24,433.82	11,338.00
# gaps	0	0
# paths	84	3
# edges	8	4
Average degree	0.10	1.33
# connected components	2	1
Largest connected component length	96,664	34,014
# dead ends	162	3
# disconnected components	78	0
Total length disconnected components	1,895,760	0
# separated components	80	1
# bubbles	0	0
# circular segments	0	0
# circular paths	0	0
Scaffold N10	93,875	12,505
Scaffold N20	38,474	12,505
Scaffold N30	26,760	12,505
Scaffold N40	24,256	11,612
Scaffold N50	22,011	11,612
Scaffold N50	22,011	11,612
Scaffold N60	20,526	11,612
Scaffold N70	19,727	11,612
Scaffold N80	19,045	9,897
Scaffold N90	17,730	9,897
Scaffold N100	15,406	9,897
Scaffold L10	2	1
Scaffold L20	7	1
Scaffold L30	14	1
Scaffold L40	22	2
Scaffold L50	31	2
Scaffold L50	31	2
Scaffold L60	40	2
Scaffold L70	51	2
Scaffold L80	61	3
Scaffold L90	72	3
Scaffold L100	84	3
Scaffold NG10	46,449	0
Scaffold NG20	31,085	0
Scaffold NG30	25,225	0
Scaffold NG40	23,513	0
Scaffold NG50	20,895	0
Scaffold NG50	20,895	0
Scaffold NG60	19,871	0
Scaffold NG70	19,102	0
Scaffold NG80	17,885	0
Scaffold NG90	0	0
Scaffold NG100	0	0
Scaffold LG10	3	0
Scaffold LG20	8	0
Scaffold LG30	16	0
Scaffold LG40	26	0
Scaffold LG50	36	0
Scaffold LG50	36	0
Scaffold LG60	47	0
Scaffold LG70	59	0
Scaffold LG80	71	0
Scaffold LG90	0	0
Scaffold LG100	0	0
Contig N10	93,875	12,505
Contig N20	38,474	12,505
Contig N30	26,760	12,505
Contig N40	24,256	11,612
Contig N50	22,011	11,612
Contig N50	22,011	11,612
Contig N60	20,526	11,612
Contig N70	19,727	11,612
Contig N80	19,045	9,897
Contig N90	17,730	9,897
Contig N100	15,406	9,897
Contig L10	2	1
Contig L20	7	1
Contig L30	14	1
Contig L40	22	2
Contig L50	31	2
Contig L50	31	2
Contig L60	40	2
Contig L70	51	2
Contig L80	61	3
Contig L90	72	3
Contig L100	84	3
Contig NG10	46,449	0
Contig NG20	31,085	0
Contig NG30	25,225	0
Contig NG40	23,513	0
Contig NG50	20,895	0
Contig NG50	20,895	0
Contig NG60	19,871	0
Contig NG70	19,102	0
Contig NG80	17,885	0
Contig NG90	0	0
Contig NG100	0	0
Contig LG10	3	0
Contig LG20	8	0
Contig LG30	16	0
Contig LG40	26	0
Contig LG50	36	0
Contig LG50	36	0
Contig LG60	47	0
Contig LG70	59	0
Contig LG80	71	0
Contig LG90	0	0
Contig LG100	0	0
Gap N10	0	0
Gap N20	0	0
Gap N30	0	0
Gap N40	0	0
Gap N50	0	0
Gap N60	0	0
Gap N70	0	0
Gap N80	0	0
Gap N90	0	0
Gap N100	0	0
Gap L10	0	0
Gap L20	0	0
Gap L30	0	0
Gap L40	0	0
Gap L50	0	0
Gap L60	0	0
Gap L70	0	0
Gap L80	0	0
Gap L90	0	0
Gap L100	0	0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection:
- step_state: scheduled
Step 2: Meryl Database:
- step_state: scheduled
Step 11: Name of alternate assembly:
- step_state: scheduled

Step 12: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpa8tjyvt3/files/8/b/f/dataset_8bf3bd90-7458-4c3a-9e06-be531517e889.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["report", "json_stats"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 13: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpa8tjyvt3/files/f/7/8/dataset_f785c32c-ded8-4b26-b927-69a615269068.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/6/outputs/dataset_3df2b6d0-b587-41a7-aa24-369b5e514f75.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}, {"__index__": 1, "value": "37"}]}}`

Step 15: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpa8tjyvt3/job_working_directory/000/8/configs/tmp6ywfg31_' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa8tjyvt3/files/1/d/4/dataset_1d46256e-8164-417d-9fcc-6d26e82a5da1.dat' '/tmp/tmpa8tjyvt3/job_working_directory/000/8/outputs/dataset_f05236d2-410c-48ec-9e10-5f9d530847a6.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 16: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpa8tjyvt3/files/8/a/b/dataset_8ab7206b-8669-4dce-b006-b9a459e18075.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.2 now available!
       file_search | Search path: /tmp/tmpa8tjyvt3/job_working_directory/000/9/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 118    93 Dec  9 04:29 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 118    66 Dec  9 04:29 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 118    70 Dec  9 04:29 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 118   124 Dec  9 04:29 multiqc_citations.txt
-rw-r--r-- 1 1001 118   222 Dec  9 04:29 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 118 39111 Dec  9 04:29 multiqc_data.json
-rw-r--r-- 1 1001 118   105 Dec  9 04:29 multiqc_general_stats.txt
-rw-r--r-- 1 1001 118    29 Dec  9 04:29 multiqc_software_versions.txt
-rw-r--r-- 1 1001 118   193 Dec  9 04:29 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpa8tjyvt3/files/3/d/f/dataset_3df2b6d0-b587-41a7-aa24-369b5e514f75.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/10/outputs/dataset_822a8bce-da1a-4fa8-a5aa-a650fb1be6a2.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 18: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa8tjyvt3/files/f/0/5/dataset_f05236d2-410c-48ec-9e10-5f9d530847a6.dat' 'c7' T '/tmp/tmpa8tjyvt3/job_working_directory/000/11/outputs/dataset_c33819f6-e583-4f45-9491-9b8cf06f2919.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 19: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpa8tjyvt3/files/8/2/2/dataset_822a8bce-da1a-4fa8-a5aa-a650fb1be6a2.dat s /tmp/tmpa8tjyvt3/job_working_directory/000/12/outputs/dataset_4e3d1853-f54c-4c13-b4c5-f7598af692b3.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 20: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 3: Genomescope Summary:
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa8tjyvt3/files/4/e/3/dataset_4e3d1853-f54c-4c13-b4c5-f7598af692b3.dat' 'c3' T '/tmp/tmpa8tjyvt3/job_working_directory/000/14/outputs/dataset_6fd63266-3e23-4cfd-9da8-2ca5789b78e0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 23: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpa8tjyvt3/files/3/6/e/dataset_36e2e7bb-a006-446e-9a5f-72638f821aa8.dat' input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -k 51 -w 51 -D 5.0 -N 100 -r 3 --max-kocc 20000  -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -l 0 -s 0.75 -O 1    --primary input_0.fastqsanger.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastqsanger.gz"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
advanced_options	`{"__current_case__": 1, "advanced_selector": "set", "correction_rounds": "3", "drop_kmers": "5.0", "hg_size": "", "hifiasm_kmer_length": "51", "max_kocc": "20000", "max_overlaps": "100", "min_hist_cnt": null, "window_size": "51"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 1, "minimum_overlap": "1", "n_hap": null, "purge_level": "0", "purge_max": null, "purge_selector": "set", "similarity_threshold": "0.75"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 25: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpa8tjyvt3/files/7/3/b/dataset_73b3fa30-cb23-4d3f-ab99-2bd88a1ffde8.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.jpg' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"jpg"`
width	`None`

Step 26: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/f/c/a/dataset_fca2cc82-67df-4e71-9c7c-63e8e9f1088b.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 3
Total scaffold length: 34014
Average scaffold length: 11338.00
Scaffold N50: 11612
Scaffold auN: 11441.29
Scaffold L50: 2
Largest scaffold: 12505
Smallest scaffold: 9897
# contigs: 3
Total contig length: 34014
Average contig length: 11338.00
Contig N50: 11612
Contig auN: 11441.29
Contig L50: 2
Largest contig: 12505
Smallest contig: 9897
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 9774:7208:7720:9312
GC content %: 43.89
# soft-masked bases: 0
# segments: 3
Total segment length: 34014
Average segment length: 11338.00
# gaps: 0
# paths: 3
# edges: 4
Average degree: 1.33
# connected components: 1
Largest connected component length: 34014
# dead ends: 3
# disconnected components: 0
Total length disconnected components: 0
# separated components: 1
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/a/4/3/dataset_a430a136-f181-477d-a35a-0d5497890bf8.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 84
Total scaffold length: 2052441
Average scaffold length: 24433.82
Scaffold N50: 22011
Scaffold auN: 34199.59
Scaffold L50: 31
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 84
Total contig length: 2052441
Average contig length: 24433.82
Contig N50: 22011
Contig auN: 34199.59
Contig L50: 31
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 627800:397884:399253:627504
GC content %: 38.84
# soft-masked bases: 0
# segments: 84
Total segment length: 2052441
Average segment length: 24433.82
# gaps: 0
# paths: 84
# edges: 8
Average degree: 0.10
# connected components: 2
Largest connected component length: 96664
# dead ends: 162
# disconnected components: 78
Total length disconnected components: 1895760
# separated components: 80
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/a/4/3/dataset_a430a136-f181-477d-a35a-0d5497890bf8.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 84
Total scaffold length: 2052441
Average scaffold length: 24433.82
Scaffold N50: 22011
Scaffold auN: 34199.59
Scaffold L50: 31
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 84
Total contig length: 2052441
Average contig length: 24433.82
Contig N50: 22011
Contig auN: 34199.59
Contig L50: 31
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 627800:397884:399253:627504
GC content %: 38.84
# soft-masked bases: 0
# segments: 84
Total segment length: 2052441
Average segment length: 24433.82
# gaps: 0
# paths: 84
# edges: 8
Average degree: 0.10
# connected components: 2
Largest connected component length: 96664
# dead ends: 162
# disconnected components: 78
Total length disconnected components: 1895760
# separated components: 80
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/f/c/a/dataset_fca2cc82-67df-4e71-9c7c-63e8e9f1088b.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 3
Total scaffold length: 34014
Average scaffold length: 11338.00
Scaffold N50: 11612
Scaffold auN: 11441.29
Scaffold L50: 2
Largest scaffold: 12505
Smallest scaffold: 9897
# contigs: 3
Total contig length: 34014
Average contig length: 11338.00
Contig N50: 11612
Contig auN: 11441.29
Contig L50: 2
Largest contig: 12505
Smallest contig: 9897
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 9774:7208:7720:9312
GC content %: 43.89
# soft-masked bases: 0
# segments: 3
Total segment length: 34014
Average segment length: 11338.00
# gaps: 0
# paths: 3
# edges: 4
Average degree: 1.33
# connected components: 1
Largest connected component length: 34014
# dead ends: 3
# disconnected components: 0
Total length disconnected components: 0
# separated components: 1
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/a/4/3/dataset_a430a136-f181-477d-a35a-0d5497890bf8.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpa8tjyvt3/job_working_directory/000/23/outputs/dataset_b28c56cd-ab70-40e0-ba0c-0bd5c65b677a.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Bits for Hifiasm bloom filter:
- step_state: scheduled

Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/f/c/a/dataset_fca2cc82-67df-4e71-9c7c-63e8e9f1088b.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpa8tjyvt3/job_working_directory/000/24/outputs/dataset_299744a3-fcd5-4977-97ec-eedb63de8bd0.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/a/4/3/dataset_a430a136-f181-477d-a35a-0d5497890bf8.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpa8tjyvt3/job_working_directory/000/25/outputs/dataset_33cb3283-cd2f-4d53-b16f-83f4d6420fa0.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpa8tjyvt3/files/f/c/a/dataset_fca2cc82-67df-4e71-9c7c-63e8e9f1088b.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpa8tjyvt3/job_working_directory/000/26/outputs/dataset_957c04c0-95d1-4f5b-a398-6487260933d6.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpa8tjyvt3/files/8/2/4/dataset_824a6743-a59d-4a06-b029-d834bbc4a4f1.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --metaeuk  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-12-09 04:56:02 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-12-09 04:34:57 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 12/09/2024 04:34:57 *****
2024-12-09 04:34:57 INFO:	Configuring BUSCO with local environment
2024-12-09 04:34:57 INFO:	Running genome mode
2024-12-09 04:35:01 INFO:	Input file is /tmp/tmpa8tjyvt3/files/8/2/4/dataset_824a6743-a59d-4a06-b029-d834bbc4a4f1.dat
2024-12-09 04:35:01 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_met
2024-12-09 04:35:01 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_met
2024-12-09 04:35:02 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-12-09 04:35:02 INFO:	Running 1 job(s) on bbtools, starting at 12/09/2024 04:35:02
2024-12-09 04:35:03 INFO:	[bbtools]	1 of 1 task(s) completed
2024-12-09 04:35:03 INFO:	Running 1 job(s) on metaeuk, starting at 12/09/2024 04:35:03
2024-12-09 04:40:02 INFO:	[metaeuk]	1 of 1 task(s) completed
2024-12-09 04:40:02 INFO:	***** Run HMMER on gene sequences *****
2024-12-09 04:40:02 INFO:	Running 3354 job(s) on hmmsearch, starting at 12/09/2024 04:40:02
2024-12-09 04:40:40 INFO:	[hmmsearch]	336 of 3354 task(s) completed
2024-12-09 04:41:15 INFO:	[hmmsearch]	671 of 3354 task(s) completed
2024-12-09 04:41:48 INFO:	[hmmsearch]	1007 of 3354 task(s) completed
2024-12-09 04:42:22 INFO:	[hmmsearch]	1342 of 3354 task(s) completed
2024-12-09 04:42:57 INFO:	[hmmsearch]	1677 of 3354 task(s) completed
2024-12-09 04:43:29 INFO:	[hmmsearch]	2013 of 3354 task(s) completed
2024-12-09 04:44:01 INFO:	[hmmsearch]	2348 of 3354 task(s) completed
2024-12-09 04:44:32 INFO:	[hmmsearch]	2684 of 3354 task(s) completed
2024-12-09 04:45:05 INFO:	[hmmsearch]	3019 of 3354 task(s) completed
2024-12-09 04:45:44 INFO:	[hmmsearch]	3354 of 3354 task(s) completed
2024-12-09 04:45:45 INFO:	59 exons in total
2024-12-09 04:45:45 INFO:	Extracting missing and fragmented buscos from the file refseq_db.faa...
2024-12-09 04:47:32 INFO:	Running 1 job(s) on metaeuk, starting at 12/09/2024 04:47:32
2024-12-09 04:55:23 INFO:	[metaeuk]	1 of 1 task(s) completed
2024-12-09 04:55:23 INFO:	***** Run HMMER on gene sequences *****
2024-12-09 04:55:23 INFO:	Running 3314 job(s) on hmmsearch, starting at 12/09/2024 04:55:23
2024-12-09 04:55:27 INFO:	[hmmsearch]	332 of 3314 task(s) completed
2024-12-09 04:55:31 INFO:	[hmmsearch]	663 of 3314 task(s) completed
2024-12-09 04:55:34 INFO:	[hmmsearch]	995 of 3314 task(s) completed
2024-12-09 04:55:37 INFO:	[hmmsearch]	1326 of 3314 task(s) completed
2024-12-09 04:55:41 INFO:	[hmmsearch]	1657 of 3314 task(s) completed
2024-12-09 04:55:44 INFO:	[hmmsearch]	1989 of 3314 task(s) completed
2024-12-09 04:55:48 INFO:	[hmmsearch]	2320 of 3314 task(s) completed
2024-12-09 04:55:52 INFO:	[hmmsearch]	2652 of 3314 task(s) completed
2024-12-09 04:55:55 INFO:	[hmmsearch]	2983 of 3314 task(s) completed
2024-12-09 04:55:58 INFO:	[hmmsearch]	3314 of 3314 task(s) completed
2024-12-09 04:55:59 INFO:	4 candidate overlapping regions found
2024-12-09 04:55:59 INFO:	65 exons in total
2024-12-09 04:55:59 INFO:	Results:	C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354	   

2024-12-09 04:55:59 INFO:	

    ---------------------------------------------------
    |Results from dataset vertebrata_odb10             |
    ---------------------------------------------------
    |C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354       |
    |40    Complete BUSCOs (C)                         |
    |39    Complete and single-copy BUSCOs (S)         |
    |1    Complete and duplicated BUSCOs (D)           |
    |15    Fragmented BUSCOs (F)                       |
    |3299    Missing BUSCOs (M)                        |
    |3354    Total BUSCO groups searched               |
    ---------------------------------------------------
2024-12-09 04:55:59 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1258 seconds

***** Summary of warnings: *****
2024-12-09 04:35:01 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_met
2024-12-09 04:35:01 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_met

2024-12-09 04:55:59 INFO:	Results written in /tmp/tmpa8tjyvt3/job_working_directory/000/27/working/busco_galaxy
2024-12-09 04:55:59 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-12-09 04:55:59 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 140
drwxr-xr-x 5 1001 118  4096 Dec  9 04:35 busco_sequences
-rw-r--r-- 1 1001 118 76855 Dec  9 04:55 full_table.tsv
drwxr-xr-x 4 1001 118  4096 Dec  9 04:45 hmmer_output
drwxr-xr-x 4 1001 118  4096 Dec  9 04:55 metaeuk_output
-rw-r--r-- 1 1001 118 42328 Dec  9 04:55 missing_busco_list.tsv
-rw-r--r-- 1 1001 118  2953 Dec  9 04:55 short_summary.json
-rw-r--r-- 1 1001 118   969 Dec  9 04:55 short_summary.txt
2024-12-09 04:56:00 INFO:	****************** Start plot generation at 12/09/2024 04:56:00 ******************
2024-12-09 04:56:00 INFO:	Load data ...
2024-12-09 04:56:00 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-12-09 04:56:00 INFO:	Generate the R code ...
2024-12-09 04:56:00 INFO:	Run the R code ...
2024-12-09 04:56:02 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-12-09 04:56:02 INFO:	Plot generation done. Total running time: 2.008241891860962 seconds
2024-12-09 04:56:02 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "metaeuk"}}`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 35: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpa8tjyvt3/files/6/f/e/dataset_6feb18d2-a0e2-4afe-ab26-4d4dfd3ed428.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpa8tjyvt3/files/8/2/4/dataset_824a6743-a59d-4a06-b029-d834bbc4a4f1.dat' assembly_01.fasta && ln -s '/tmp/tmpa8tjyvt3/files/0/7/3/dataset_073d3996-2586-4d46-8627-a5128f5306b4.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpa8tjyvt3/job_working_directory/000/28/outputs/dataset_30e4ca22-d70e-4344-a813-46cfd9940b2a.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 28, "src": "hda"}]}, "assembly_02": {"values": [{"id": 29, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "options": "default"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "stats", "log", "hist"]`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpa8tjyvt3/job_working_directory/000/29/configs/tmpfuagts2e' '/tmp/tmpa8tjyvt3/files/b/2/8/dataset_b28c56cd-ab70-40e0-ba0c-0bd5c65b677a.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/29/outputs/dataset_3c8a019f-0e45-4790-8636-2b0aba7cad92.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\tPrimary\"}; {print}; \n"`
dbkey	`"?"`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpa8tjyvt3/job_working_directory/000/30/configs/tmp4v__0zu0' '/tmp/tmpa8tjyvt3/files/2/9/9/dataset_299744a3-fcd5-4977-97ec-eedb63de8bd0.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/30/outputs/dataset_fead2a70-aeec-4c28-9f3a-df2388203fc1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\tAlternate\"}; {print}; \n"`
dbkey	`"?"`

Step 38: Data Prep Primary:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpa8tjyvt3/files/3/3/c/dataset_33cb3283-cd2f-4d53-b16f-83f4d6420fa0.dat' --output='/tmp/tmpa8tjyvt3/job_working_directory/000/31/outputs/dataset_26121475-be60-4301-a08d-e6cb89158c4a.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpa8tjyvt3/job_working_directory/000/32/configs/tmpw31_2mdk' '/tmp/tmpa8tjyvt3/files/2/6/1/dataset_26121475-be60-4301-a08d-e6cb89158c4a.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/32/outputs/dataset_d4cd66af-dbdb-4913-960d-f8eb1757e0d0.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpa8tjyvt3/files/d/4/c/dataset_d4cd66af-dbdb-4913-960d-f8eb1757e0d0.dat > '/tmp/tmpa8tjyvt3/job_working_directory/000/33/outputs/dataset_1bf3c456-44f5-40bc-bf29-35c418fef772.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa8tjyvt3/files/d/4/c/dataset_d4cd66af-dbdb-4913-960d-f8eb1757e0d0.dat" "/tmp/tmpa8tjyvt3/job_working_directory/000/34/outputs/dataset_c0d0da27-64a4-479a-a812-a763fcfe84c1.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "2052441", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpa8tjyvt3/job_working_directory/000/51/configs/tmpt12cnpbe' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa8tjyvt3/files/c/0/d/dataset_c0d0da27-64a4-479a-a812-a763fcfe84c1.dat' '/tmp/tmpa8tjyvt3/job_working_directory/000/51/outputs/dataset_c21bb30e-5dce-4781-8408-0523833edf56.dat'

Exit Code:

```
0
```

Standard Output:

c3/2052441
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/2052441;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 84 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3db5e511ef84db6045bd4c16a9"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/2052441"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 39: Data Prep Alternate:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpa8tjyvt3/files/9/5/7/dataset_957c04c0-95d1-4f5b-a398-6487260933d6.dat' --output='/tmp/tmpa8tjyvt3/job_working_directory/000/36/outputs/dataset_0a60a4dc-7fdd-4bdc-8a90-bf35d45078b9.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpa8tjyvt3/job_working_directory/000/37/configs/tmpurox31vm' '/tmp/tmpa8tjyvt3/files/0/a/6/dataset_0a60a4dc-7fdd-4bdc-8a90-bf35d45078b9.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/37/outputs/dataset_517f3ab8-cff6-458d-bad9-323dce47b716.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpa8tjyvt3/files/5/1/7/dataset_517f3ab8-cff6-458d-bad9-323dce47b716.dat > '/tmp/tmpa8tjyvt3/job_working_directory/000/38/outputs/dataset_fbe31b83-31f9-4439-8a3d-594d34bded8d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa8tjyvt3/files/5/1/7/dataset_517f3ab8-cff6-458d-bad9-323dce47b716.dat" "/tmp/tmpa8tjyvt3/job_working_directory/000/39/outputs/dataset_a4dc3382-73d3-461f-8104-7186f0ebcddc.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "34014", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpa8tjyvt3/job_working_directory/000/52/configs/tmpwz28zg3a' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa8tjyvt3/files/a/4/d/dataset_a4dc3382-73d3-461f-8104-7186f0ebcddc.dat' '/tmp/tmpa8tjyvt3/job_working_directory/000/52/outputs/dataset_89175c7c-bc36-4a49-98db-c4f3db2b4137.dat'

Exit Code:

```
0
```

Standard Output:

c3/34014
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/34014;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 3 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3eb5e511ef84db6045bd4c16a9"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/34014"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 40: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
input	`{"values": [{"id": 6, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 5: Homozygous Read Coverage:
- step_state: scheduled

Step 41: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 42: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 43: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 44: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
input	`{"values": [{"id": 8, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 45: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/join.py' '/tmp/tmpa8tjyvt3/files/3/c/8/dataset_3c8a019f-0e45-4790-8636-2b0aba7cad92.dat' '/tmp/tmpa8tjyvt3/files/f/e/a/dataset_fead2a70-aeec-4c28-9f3a-df2388203fc1.dat' 1 1 '/tmp/tmpa8tjyvt3/job_working_directory/000/41/outputs/dataset_1fe5177c-44fc-4628-bf54-20019d2a51ab.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpa8tjyvt3/job_working_directory/000/41/configs/tmpimizf0em

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 46: Plotting Nx and Sizes:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpa8tjyvt3/job_working_directory/000/59/configs/tmpfb1u94th' && Rscript '/tmp/tmpa8tjyvt3/job_working_directory/000/59/configs/tmpfb1u94th'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpa8tjyvt3/files/c/e/7/dataset_ce7476a6-b7ac-4fe7-bf7b-9956c7ea38f9.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpa8tjyvt3/job_working_directory/000/59/outputs/dataset_603dff67-7793-4288-8040-fc06786e7cd0.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa8tjyvt3/files/c/2/1/dataset_c21bb30e-5dce-4781-8408-0523833edf56.dat" "/tmp/tmpa8tjyvt3/job_working_directory/000/53/outputs/dataset_d4d72649-13aa-49cc-a229-db71e4ecb9e4.dat" "Primary" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Primary"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa8tjyvt3/files/8/9/1/dataset_89175c7c-bc36-4a49-98db-c4f3db2b4137.dat" "/tmp/tmpa8tjyvt3/job_working_directory/000/54/outputs/dataset_756f11cb-0237-4b56-91b4-c1e7fc7f004e.dat" "Alternate" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Alternate"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpa8tjyvt3/files/d/4/d/dataset_d4d72649-13aa-49cc-a229-db71e4ecb9e4.dat' >> '/tmp/tmpa8tjyvt3/job_working_directory/000/55/outputs/dataset_3ad65ee9-6c18-47fc-862a-6c1c866f2fe8.dat' && cat '/tmp/tmpa8tjyvt3/files/7/5/6/dataset_756f11cb-0237-4b56-91b4-c1e7fc7f004e.dat' >> '/tmp/tmpa8tjyvt3/job_working_directory/000/55/outputs/dataset_3ad65ee9-6c18-47fc-862a-6c1c866f2fe8.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 90, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa8tjyvt3/files/3/a/d/dataset_3ad65ee9-6c18-47fc-862a-6c1c866f2fe8.dat' 'c8,c5,c6' T '/tmp/tmpa8tjyvt3/job_working_directory/000/56/outputs/dataset_5c574fdb-4cdc-4a9a-82c6-3a96144a631e.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpa8tjyvt3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa8tjyvt3/files/3/a/d/dataset_3ad65ee9-6c18-47fc-862a-6c1c866f2fe8.dat' 'c8,c4,c7' T '/tmp/tmpa8tjyvt3/job_working_directory/000/57/outputs/dataset_ce7476a6-b7ac-4fe7-bf7b-9956c7ea38f9.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpa8tjyvt3/job_working_directory/000/58/configs/tmp8udz7es8' && Rscript '/tmp/tmpa8tjyvt3/job_working_directory/000/58/configs/tmp8udz7es8'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpa8tjyvt3/files/5/c/5/dataset_5c574fdb-4cdc-4a9a-82c6-3a96144a631e.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpa8tjyvt3/job_working_directory/000/58/outputs/dataset_dc983450-f6ab-43af-b0cc-76524019fe3a.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3fb5e511ef84db6045bd4c16a9"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 47: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpa8tjyvt3/files/1/f/e/dataset_1fe5177c-44fc-4628-bf54-20019d2a51ab.dat' > '/tmp/tmpa8tjyvt3/job_working_directory/000/42/outputs/dataset_12844d87-15ff-418d-a9b0-15a753c4178d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 48: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpa8tjyvt3/job_working_directory/000/43/outputs/dataset_80b46cee-93fd-4a94-ba6b-3460289b8fe7.dat' -g     '#' 'Number of' '/tmp/tmpa8tjyvt3/files/1/2/8/dataset_12844d87-15ff-418d-a9b0-15a753c4178d.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"f78f2d3cb5e511ef84db6045bd4c16a9"`
chromInfo	`"/tmp/tmpa8tjyvt3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 6: Genomescope Model Parameters:
- step_state: scheduled
Step 7: Database for Busco Lineage:
- step_state: scheduled
Step 8: Lineage:
- step_state: scheduled
Step 9: SAK input file (Optional):
- step_state: scheduled
Step 10: Name of primary assembly:
- step_state: scheduled

Other invocation details
- history_id
  - 53de73dd70c4fbb5
- history_state
  - ok
- invocation_id
  - 53de73dd70c4fbb5
- invocation_state
  - scheduled
- workflow_id
  - a3e2942fdbc6defc

… to 0.2.3

gxydevbot · 2024-12-16T04:35:59Z

There are new updates, they have been integrated to the PR, check the file diff.

github-actions · 2024-12-16T05:15:02Z

Test Results (powered by Planemo)

Test Summary

Test State	Count
Total	1
Passed	0
Error	0
Failure	1
Skipped	0

Failed Tests

❌ Assembly-Hifi-only-VGP3.ga_0

Problems:

Output with path /tmp/tmprqugwc6u/Hifiasm Primary assembly__3c5f52df-9e1b-4009-ba59-9112e1b6d028 different than expected
Expected 170+-0 lines in the output found 168

Output with path /tmp/tmpnw2l4u6b/Hifiasm Alternate assembly__c76b7a37-9513-4ac1-8705-88621404f718 different than expected
Expected 2+-0 lines in the output found 6

Output with path /tmp/tmp3y1ih0b3/gfastats on data 28 stats__f555913d-19c0-4e07-8cbe-b5adbdbd7344 different than expected
Expected line '# scaffolds	1' in output ('Expected genome size	2,288,021
# scaffolds	3
Total scaffold length	34,014
Average scaffold length	11,338.00
Scaffold N50	11,612
Scaffold auN	11,441.29
Scaffold L50	2
Scaffold NG50	0
Scaffold auNG	170.09
Scaffold LG50	0
Largest scaffold	12,505
Smallest scaffold	9,897
# contigs	3
Total contig length	34,014
Average contig length	11,338.00
Contig N50	11,612
Contig auN	11,441.29
Contig L50	2
Contig NG50	0
Contig auNG	170.09
Contig LG50	0
Largest contig	12,505
Smallest contig	9,897
# gaps in scaffolds	0
Total gap length in scaffolds	0
Average gap length in scaffolds	0.00
Gap N50 in scaffolds	0
Gap auN in scaffolds	0.00
Gap L50 in scaffolds	0
Largest gap in scaffolds	0
Smallest gap in scaffolds	0
Base composition (A:C:G:T)	9,774:7,208:7,720:9,312
GC content %	43.89
# soft-masked bases	0
# segments	3
Total segment length	34,014
Average segment length	11,338.00
# gaps	0
# paths	3
# edges	4
Average degree	1.33
# connected components	1
Largest connected component length	34,014
# dead ends	3
# disconnected components	0
Total length disconnected components	0
# separated components	1
# bubbles	0
# circular segments	0
# circular paths	0
Scaffold N10	12,505
Scaffold N20	12,505
Scaffold N30	12,505
Scaffold N40	11,612
Scaffold N50	11,612
Scaffold N60	11,612
Scaffold N70	11,612
Scaffold N80	9,897
Scaffold N90	9,897
Scaffold N100	9,897
Scaffold L10	1
Scaffold L20	1
Scaffold L30	1
Scaffold L40	2
Scaffold L50	2
Scaffold L60	2
Scaffold L70	2
Scaffold L80	3
Scaffold L90	3
Scaffold L100	3
Scaffold NG10	0
Scaffold NG20	0
Scaffold NG30	0
Scaffold NG40	0
Scaffold NG50	0
Scaffold NG60	0
Scaffold NG70	0
Scaffold NG80	0
Scaffold NG90	0
Scaffold NG100	0
Scaffold LG10	0
Scaffold LG20	0
Scaffold LG30	0
Scaffold LG40	0
Scaffold LG50	0
Scaffold LG60	0
Scaffold LG70	0
Scaffold LG80	0
Scaffold LG90	0
Scaffold LG100	0
Contig N10	12,505
Contig N20	12,505
Contig N30	12,505
Contig N40	11,612
Contig N50	11,612
Contig N60	11,612
Contig N70	11,612
Contig N80	9,897
Contig N90	9,897
Contig N100	9,897
Contig L10	1
Contig L20	1
Contig L30	1
Contig L40	2
Contig L50	2
Contig L60	2
Contig L70	2
Contig L80	3
Contig L90	3
Contig L100	3
Contig NG10	0
Contig NG20	0
Contig NG30	0
Contig NG40	0
Contig NG50	0
Contig NG60	0
Contig NG70	0
Contig NG80	0
Contig NG90	0
Contig NG100	0
Contig LG10	0
Contig LG20	0
Contig LG30	0
Contig LG40	0
Contig LG50	0
Contig LG60	0
Contig LG70	0
Contig LG80	0
Contig LG90	0
Contig LG100	0
Gap N10	0
Gap N20	0
Gap N30	0
Gap N40	0
Gap N50	0
Gap N60	0
Gap N70	0
Gap N80	0
Gap N90	0
Gap N100	0
Gap L10	0
Gap L20	0
Gap L30	0
Gap L40	0
Gap L50	0
Gap L60	0
Gap L70	0
Gap L80	0
Gap L90	0
Gap L100	0
')

Output with path /tmp/tmpdyqzbyyb/gfastats on data 27 stats__b84ee980-3d44-47a4-8fcf-0d5b46205402 different than expected
Expected line '# scaffolds	85' in output ('Expected genome size	2,288,021
# scaffolds	84
Total scaffold length	2,052,441
Average scaffold length	24,433.82
Scaffold N50	22,011
Scaffold auN	34,199.59
Scaffold L50	31
Scaffold NG50	20,895
Scaffold auNG	30,678.32
Scaffold LG50	36
Largest scaffold	132,684
Smallest scaffold	15,406
# contigs	84
Total contig length	2,052,441
Average contig length	24,433.82
Contig N50	22,011
Contig auN	34,199.59
Contig L50	31
Contig NG50	20,895
Contig auNG	30,678.32
Contig LG50	36
Largest contig	132,684
Smallest contig	15,406
# gaps in scaffolds	0
Total gap length in scaffolds	0
Average gap length in scaffolds	0.00
Gap N50 in scaffolds	0
Gap auN in scaffolds	0.00
Gap L50 in scaffolds	0
Largest gap in scaffolds	0
Smallest gap in scaffolds	0
Base composition (A:C:G:T)	627,800:397,884:399,253:627,504
GC content %	38.84
# soft-masked bases	0
# segments	84
Total segment length	2,052,441
Average segment length	24,433.82
# gaps	0
# paths	84
# edges	8
Average degree	0.10
# connected components	2
Largest connected component length	96,664
# dead ends	162
# disconnected components	78
Total length disconnected components	1,895,760
# separated components	80
# bubbles	0
# circular segments	0
# circular paths	0
Scaffold N10	93,875
Scaffold N20	38,474
Scaffold N30	26,760
Scaffold N40	24,256
Scaffold N50	22,011
Scaffold N60	20,526
Scaffold N70	19,727
Scaffold N80	19,045
Scaffold N90	17,730
Scaffold N100	15,406
Scaffold L10	2
Scaffold L20	7
Scaffold L30	14
Scaffold L40	22
Scaffold L50	31
Scaffold L60	40
Scaffold L70	51
Scaffold L80	61
Scaffold L90	72
Scaffold L100	84
Scaffold NG10	46,449
Scaffold NG20	31,085
Scaffold NG30	25,225
Scaffold NG40	23,513
Scaffold NG50	20,895
Scaffold NG60	19,871
Scaffold NG70	19,102
Scaffold NG80	17,885
Scaffold NG90	0
Scaffold NG100	0
Scaffold LG10	3
Scaffold LG20	8
Scaffold LG30	16
Scaffold LG40	26
Scaffold LG50	36
Scaffold LG60	47
Scaffold LG70	59
Scaffold LG80	71
Scaffold LG90	0
Scaffold LG100	0
Contig N10	93,875
Contig N20	38,474
Contig N30	26,760
Contig N40	24,256
Contig N50	22,011
Contig N60	20,526
Contig N70	19,727
Contig N80	19,045
Contig N90	17,730
Contig N100	15,406
Contig L10	2
Contig L20	7
Contig L30	14
Contig L40	22
Contig L50	31
Contig L60	40
Contig L70	51
Contig L80	61
Contig L90	72
Contig L100	84
Contig NG10	46,449
Contig NG20	31,085
Contig NG30	25,225
Contig NG40	23,513
Contig NG50	20,895
Contig NG60	19,871
Contig NG70	19,102
Contig NG80	17,885
Contig NG90	0
Contig NG100	0
Contig LG10	3
Contig LG20	8
Contig LG30	16
Contig LG40	26
Contig LG50	36
Contig LG60	47
Contig LG70	59
Contig LG80	71
Contig LG90	0
Contig LG100	0
Gap N10	0
Gap N20	0
Gap N30	0
Gap N40	0
Gap N50	0
Gap N60	0
Gap N70	0
Gap N80	0
Gap N90	0
Gap N100	0
Gap L10	0
Gap L20	0
Gap L30	0
Gap L40	0
Gap L50	0
Gap L60	0
Gap L70	0
Gap L80	0
Gap L90	0
Gap L100	0
')

Output with path /tmp/tmps4n8t6i4/Assembly statistics__48564299-f732-4b67-b96d-50faf546ed65 different than expected
Expected line '# scaffolds	85	1' in output ('Metric	Primary	Alternate
Expected genome size	2,288,021	2,288,021
# scaffolds	84	3
Total scaffold length	2,052,441	34,014
Average scaffold length	24,433.82	11,338.00
Scaffold N50	22,011	11,612
Scaffold N50	22,011	11,612
Scaffold auN	34,199.59	11,441.29
Scaffold L50	31	2
Scaffold L50	31	2
Scaffold NG50	20,895	0
Scaffold NG50	20,895	0
Scaffold auNG	30,678.32	170.09
Scaffold LG50	36	0
Scaffold LG50	36	0
Largest scaffold	132,684	12,505
Smallest scaffold	15,406	9,897
# contigs	84	3
Total contig length	2,052,441	34,014
Average contig length	24,433.82	11,338.00
Contig N50	22,011	11,612
Contig N50	22,011	11,612
Contig auN	34,199.59	11,441.29
Contig L50	31	2
Contig L50	31	2
Contig NG50	20,895	0
Contig NG50	20,895	0
Contig auNG	30,678.32	170.09
Contig LG50	36	0
Contig LG50	36	0
Largest contig	132,684	12,505
Smallest contig	15,406	9,897
# gaps in scaffolds	0	0
Total gap length in scaffolds	0	0
Average gap length in scaffolds	0.00	0.00
Gap N50 in scaffolds	0	0
Gap auN in scaffolds	0.00	0.00
Gap L50 in scaffolds	0	0
Largest gap in scaffolds	0	0
Smallest gap in scaffolds	0	0
Base composition (A:C:G:T)	627,800:397,884:399,253:627,504	9,774:7,208:7,720:9,312
GC content %	38.84	43.89
# soft-masked bases	0	0
# segments	84	3
Total segment length	2,052,441	34,014
Average segment length	24,433.82	11,338.00
# gaps	0	0
# paths	84	3
# edges	8	4
Average degree	0.10	1.33
# connected components	2	1
Largest connected component length	96,664	34,014
# dead ends	162	3
# disconnected components	78	0
Total length disconnected components	1,895,760	0
# separated components	80	1
# bubbles	0	0
# circular segments	0	0
# circular paths	0	0
Scaffold N10	93,875	12,505
Scaffold N20	38,474	12,505
Scaffold N30	26,760	12,505
Scaffold N40	24,256	11,612
Scaffold N50	22,011	11,612
Scaffold N50	22,011	11,612
Scaffold N60	20,526	11,612
Scaffold N70	19,727	11,612
Scaffold N80	19,045	9,897
Scaffold N90	17,730	9,897
Scaffold N100	15,406	9,897
Scaffold L10	2	1
Scaffold L20	7	1
Scaffold L30	14	1
Scaffold L40	22	2
Scaffold L50	31	2
Scaffold L50	31	2
Scaffold L60	40	2
Scaffold L70	51	2
Scaffold L80	61	3
Scaffold L90	72	3
Scaffold L100	84	3
Scaffold NG10	46,449	0
Scaffold NG20	31,085	0
Scaffold NG30	25,225	0
Scaffold NG40	23,513	0
Scaffold NG50	20,895	0
Scaffold NG50	20,895	0
Scaffold NG60	19,871	0
Scaffold NG70	19,102	0
Scaffold NG80	17,885	0
Scaffold NG90	0	0
Scaffold NG100	0	0
Scaffold LG10	3	0
Scaffold LG20	8	0
Scaffold LG30	16	0
Scaffold LG40	26	0
Scaffold LG50	36	0
Scaffold LG50	36	0
Scaffold LG60	47	0
Scaffold LG70	59	0
Scaffold LG80	71	0
Scaffold LG90	0	0
Scaffold LG100	0	0
Contig N10	93,875	12,505
Contig N20	38,474	12,505
Contig N30	26,760	12,505
Contig N40	24,256	11,612
Contig N50	22,011	11,612
Contig N50	22,011	11,612
Contig N60	20,526	11,612
Contig N70	19,727	11,612
Contig N80	19,045	9,897
Contig N90	17,730	9,897
Contig N100	15,406	9,897
Contig L10	2	1
Contig L20	7	1
Contig L30	14	1
Contig L40	22	2
Contig L50	31	2
Contig L50	31	2
Contig L60	40	2
Contig L70	51	2
Contig L80	61	3
Contig L90	72	3
Contig L100	84	3
Contig NG10	46,449	0
Contig NG20	31,085	0
Contig NG30	25,225	0
Contig NG40	23,513	0
Contig NG50	20,895	0
Contig NG50	20,895	0
Contig NG60	19,871	0
Contig NG70	19,102	0
Contig NG80	17,885	0
Contig NG90	0	0
Contig NG100	0	0
Contig LG10	3	0
Contig LG20	8	0
Contig LG30	16	0
Contig LG40	26	0
Contig LG50	36	0
Contig LG50	36	0
Contig LG60	47	0
Contig LG70	59	0
Contig LG80	71	0
Contig LG90	0	0
Contig LG100	0	0
Gap N10	0	0
Gap N20	0	0
Gap N30	0	0
Gap N40	0	0
Gap N50	0	0
Gap N60	0	0
Gap N70	0	0
Gap N80	0	0
Gap N90	0	0
Gap N100	0	0
Gap L10	0	0
Gap L20	0	0
Gap L30	0	0
Gap L40	0	0
Gap L50	0	0
Gap L60	0	0
Gap L70	0	0
Gap L80	0	0
Gap L90	0	0
Gap L100	0	0
')

Workflow invocation details

Invocation Messages

Steps

Step 1: Pacbio Reads Collection:
- step_state: scheduled
Step 2: Meryl Database:
- step_state: scheduled
Step 11: Name of alternate assembly:
- step_state: scheduled

Step 12: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -f -s '/tmp/tmpb1mrmk_7/files/0/4/5/dataset_0458b990-6765-4572-ba47-927071c4735f.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT'   -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT'    --error-rate=0.1 --times=1 --overlap=35    --action=trim --rc     --discard-trimmed   --minimum-length=1      --json=stats.json -o 'out1.fq.gz'  'yeast_reads_sub1_fastq_gz.fq.gz'  > report.txt

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
adapter_options	`{"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"}`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_options	`{"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"}`
library	{"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"}
other_trimming_options	`{"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false}`
output_selector	`["report", "json_stats"]`
read_mod_options	`{"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false}`

Step 13: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpb1mrmk_7/files/6/0/6/dataset_606f7d41-e111-4849-b2c3-322590ced61f.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/6/outputs/dataset_c5e981f6-14dd-4321-8531-addd190fcc77.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
case_sensitive	`"-i"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
color	`"NOCOLOR"`
dbkey	`"?"`
invert	`""`
lines_after	`"0"`
lines_before	`"0"`
regex_type	`"-G"`
url_paste	`"Haploid"`

Step 14: toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}, {"__index__": 1, "value": "37"}]}}`

Step 15: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpb1mrmk_7/job_working_directory/000/8/configs/tmpddsbpgev' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb1mrmk_7/files/f/1/8/dataset_f18e68e7-6c7d-4cb8-80be-a36f686c0e7d.dat' '/tmp/tmpb1mrmk_7/job_working_directory/000/8/outputs/dataset_abe41f05-d099-4900-8f63-f1d30e2fc3b8.dat'

Exit Code:

```
0
```

Standard Output:

c3*2
Computing 1 new columns with instructions ['c3*2;;']
Computed new column values for 100.00% of 1 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"}`

Step 16: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpb1mrmk_7/files/c/3/a/dataset_c3a4f798-2361-4a8d-b99b-c65927113120.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true

Exit Code:

```
0
```

Standard Error:

/// MultiQC 🔍 v1.24.1

     version_check | MultiQC Version v1.25.2 now available!
       file_search | Search path: /tmp/tmpb1mrmk_7/job_working_directory/000/9/working/multiqc_WDir

          cutadapt | Found 1 reports

     write_results | Data        : report_data
     write_results | Report      : report.html
           multiqc | MultiQC complete

Standard Output:

total 72
-rw-r--r-- 1 1001 118    93 Dec 16 04:49 cutadapt_filtered_reads_plot.txt
-rw-r--r-- 1 1001 118    66 Dec 16 04:49 cutadapt_trimmed_sequences_plot_default_Counts.txt
-rw-r--r-- 1 1001 118    70 Dec 16 04:49 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
-rw-r--r-- 1 1001 118   124 Dec 16 04:49 multiqc_citations.txt
-rw-r--r-- 1 1001 118   222 Dec 16 04:49 multiqc_cutadapt.txt
-rw-r--r-- 1 1001 118 39111 Dec 16 04:49 multiqc_data.json
-rw-r--r-- 1 1001 118   105 Dec 16 04:49 multiqc_general_stats.txt
-rw-r--r-- 1 1001 118    29 Dec 16 04:49 multiqc_software_versions.txt
-rw-r--r-- 1 1001 118   193 Dec 16 04:49 multiqc_sources.txt

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
comment	`""`
dbkey	`"?"`
export	`false`
flat	`false`
results	`[{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}]`
saveLog	`"false"`
title	`""`

Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpb1mrmk_7/files/c/5/e/dataset_c5e981f6-14dd-4321-8531-addd190fcc77.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/10/outputs/dataset_f9af6ac2-0ba1-4f75-b70e-8edc8c422724.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
replacements	`[{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}]`

Step 18: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb1mrmk_7/files/a/b/e/dataset_abe41f05-d099-4900-8f63-f1d30e2fc3b8.dat' 'c7' T '/tmp/tmpb1mrmk_7/job_working_directory/000/11/outputs/dataset_d81d841e-e8b5-4af9-92c7-36356bad875a.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 19: Convert characters1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python /tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpb1mrmk_7/files/f/9/a/dataset_f9af6ac2-0ba1-4f75-b70e-8edc8c422724.dat s /tmp/tmpb1mrmk_7/job_working_directory/000/12/outputs/dataset_ff501655-d375-4dfe-a569-aecf9e13d5e6.dat

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"txt"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
condense	`true`
convert_from	`"s"`
dbkey	`"?"`
strip	`true`

Step 20: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 3: Genomescope Summary:
- step_state: scheduled

Step 21: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb1mrmk_7/files/f/f/5/dataset_ff501655-d375-4dfe-a569-aecf9e13d5e6.dat' 'c3' T '/tmp/tmpb1mrmk_7/job_working_directory/000/14/outputs/dataset_276a3726-9952-44bb-8578-4e00068b257c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c3"`
dbkey	`"?"`
delimiter	`"T"`

Step 22: Homozygous read coverage for Hifiasm:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
style_cond	`{"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}}`

Step 23: Estimated genome size:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 24: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.20.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpb1mrmk_7/files/0/2/3/dataset_02352aef-abe6-445a-8deb-c81f77f0849b.dat' input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -k 51 -w 51 -D 5.0 -N 100 -r 3 --max-kocc 20000  -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21 -l 0 -s 0.75 -O 1    --primary input_0.fastqsanger.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"fastqsanger.gz"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
advanced_options	`{"__current_case__": 1, "advanced_selector": "set", "correction_rounds": "3", "drop_kmers": "5.0", "hg_size": "", "hifiasm_kmer_length": "51", "max_kocc": "20000", "max_overlaps": "100", "min_hist_cnt": null, "window_size": "51"}`
assembly_options	`{"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"}`
bins_out	`false`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
filter_bits	`"32"`
hic_partition	`{"__current_case__": 0, "hic_partition_selector": "blank"}`
log_out	`true`
mode	`{"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}}`
ont_integration	`{"__current_case__": 0, "ont_integration_selector": "blank"}`
purge_options	`{"__current_case__": 1, "minimum_overlap": "1", "n_hap": null, "purge_level": "0", "purge_max": null, "purge_selector": "set", "similarity_threshold": "0.75"}`
scaffolding_options	`{"__current_case__": 0, "scaffold_selector": "blank"}`

Step 25: Raw Unitig Image:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

ln -s '/tmp/tmpb1mrmk_7/files/1/7/1/dataset_1716b627-b853-4e2e-b809-4b457018aaf8.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.jpg' --height '2000' --nodewidth '25.0'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
fontsize	`None`
height	`"2000"`
lengths	`false`
names	`false`
nodewidth	`"25.0"`
output_format	`"jpg"`
width	`None`

Step 26: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/f/c/4/dataset_fc4f0733-4584-409b-b28f-99c7a7b1b35a.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 3
Total scaffold length: 34014
Average scaffold length: 11338.00
Scaffold N50: 11612
Scaffold auN: 11441.29
Scaffold L50: 2
Largest scaffold: 12505
Smallest scaffold: 9897
# contigs: 3
Total contig length: 34014
Average contig length: 11338.00
Contig N50: 11612
Contig auN: 11441.29
Contig L50: 2
Largest contig: 12505
Smallest contig: 9897
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 9774:7208:7720:9312
GC content %: 43.89
# soft-masked bases: 0
# segments: 3
Total segment length: 34014
Average segment length: 11338.00
# gaps: 0
# paths: 3
# edges: 4
Average degree: 1.33
# connected components: 1
Largest connected component length: 34014
# dead ends: 3
# disconnected components: 0
Total length disconnected components: 0
# separated components: 1
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/8/e/5/dataset_8e5935ec-7214-4235-baf1-1caafa6fe7fc.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 84
Total scaffold length: 2052441
Average scaffold length: 24433.82
Scaffold N50: 22011
Scaffold auN: 34199.59
Scaffold L50: 31
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 84
Total contig length: 2052441
Average contig length: 24433.82
Contig N50: 22011
Contig auN: 34199.59
Contig L50: 31
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 627800:397884:399253:627504
GC content %: 38.84
# soft-masked bases: 0
# segments: 84
Total segment length: 2052441
Average segment length: 24433.82
# gaps: 0
# paths: 84
# edges: 8
Average degree: 0.10
# connected components: 2
Largest connected component length: 96664
# dead ends: 162
# disconnected components: 78
Total length disconnected components: 1895760
# separated components: 80
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/8/e/5/dataset_8e5935ec-7214-4235-baf1-1caafa6fe7fc.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 84
Total scaffold length: 2052441
Average scaffold length: 24433.82
Scaffold N50: 22011
Scaffold auN: 34199.59
Scaffold L50: 31
Largest scaffold: 132684
Smallest scaffold: 15406
# contigs: 84
Total contig length: 2052441
Average contig length: 24433.82
Contig N50: 22011
Contig auN: 34199.59
Contig L50: 31
Largest contig: 132684
Smallest contig: 15406
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 627800:397884:399253:627504
GC content %: 38.84
# soft-masked bases: 0
# segments: 84
Total segment length: 2052441
Average segment length: 24433.82
# gaps: 0
# paths: 84
# edges: 8
Average degree: 0.10
# connected components: 2
Largest connected component length: 96664
# dead ends: 162
# disconnected components: 78
Total length disconnected components: 1895760
# separated components: 80
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/f/c/4/dataset_fc4f0733-4584-409b-b28f-99c7a7b1b35a.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset

Exit Code:

```
0
```

Standard Output:

+++Assembly summary+++: 
# scaffolds: 3
Total scaffold length: 34014
Average scaffold length: 11338.00
Scaffold N50: 11612
Scaffold auN: 11441.29
Scaffold L50: 2
Largest scaffold: 12505
Smallest scaffold: 9897
# contigs: 3
Total contig length: 34014
Average contig length: 11338.00
Contig N50: 11612
Contig auN: 11441.29
Contig L50: 2
Largest contig: 12505
Smallest contig: 9897
# gaps in scaffolds: 0
Total gap length in scaffolds: 0
Average gap length in scaffolds: 0.00
Gap N50 in scaffolds: 0
Gap auN in scaffolds: 0.00
Gap L50 in scaffolds: 0
Largest gap in scaffolds: 0
Smallest gap in scaffolds: 0
Base composition (A:C:G:T): 9774:7208:7720:9312
GC content %: 43.89
# soft-masked bases: 0
# segments: 3
Total segment length: 34014
Average segment length: 11338.00
# gaps: 0
# paths: 3
# edges: 4
Average degree: 1.33
# connected components: 1
Largest connected component length: 34014
# dead ends: 3
# disconnected components: 0
Total length disconnected components: 0
# separated components: 1
# bubbles: 0
# circular segments: 0
# circular paths: 0

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/8/e/5/dataset_8e5935ec-7214-4235-baf1-1caafa6fe7fc.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpb1mrmk_7/job_working_directory/000/23/outputs/dataset_b84ee980-3d44-47a4-8fcf-0d5b46205402.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 4: Bits for Hifiasm bloom filter:
- step_state: scheduled

Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/f/c/4/dataset_fc4f0733-4584-409b-b28f-99c7a7b1b35a.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpb1mrmk_7/job_working_directory/000/24/outputs/dataset_f555913d-19c0-4e07-8cbe-b5adbdbd7344.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/8/e/5/dataset_8e5935ec-7214-4235-baf1-1caafa6fe7fc.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpb1mrmk_7/job_working_directory/000/25/outputs/dataset_2acfea30-53d7-4cef-8676-81fbf05f19a9.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.9+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

gfastats '/tmp/tmpb1mrmk_7/files/f/c/4/dataset_fc4f0733-4584-409b-b28f-99c7a7b1b35a.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpb1mrmk_7/job_working_directory/000/26/outputs/dataset_9d6a9ffe-a0b8-4693-aacc-27f49cbff56c.dat' --threads ${GALAXY_SLOTS:-8}

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
mode_condition	`{"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true}`
target_condition	`{"__current_case__": 0, "target_option": "false"}`

Step 34: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.8.0+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

busco --in '/tmp/tmpb1mrmk_7/files/3/c/5/dataset_3c5f52df-9e1b-4009-ba59-9112e1b6d028.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --metaeuk  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true

Exit Code:

```
0
```

Standard Error:

2024-12-16 05:13:36 ERROR:	
Warning message:
The `size` argument of `element_line()` is deprecated as of ggplot2 3.4.0.
ℹ Please use the `linewidth` argument instead.

Standard Output:

2024-12-16 04:55:33 INFO:	***** Start a BUSCO v5.8.0 analysis, current time: 12/16/2024 04:55:33 *****
2024-12-16 04:55:33 INFO:	Configuring BUSCO with local environment
2024-12-16 04:55:33 INFO:	Running genome mode
2024-12-16 04:55:39 INFO:	Input file is /tmp/tmpb1mrmk_7/files/3/c/5/dataset_3c5f52df-9e1b-4009-ba59-9112e1b6d028.dat
2024-12-16 04:55:39 WARNING:	Option evalue was provided but is not used in the selected run mode, euk_genome_met
2024-12-16 04:55:39 WARNING:	Option limit was provided but is not used in the selected run mode, euk_genome_met
2024-12-16 04:55:40 INFO:	Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
2024-12-16 04:55:40 INFO:	Running 1 job(s) on bbtools, starting at 12/16/2024 04:55:40
2024-12-16 04:55:41 INFO:	[bbtools]	1 of 1 task(s) completed
2024-12-16 04:55:41 INFO:	Running 1 job(s) on metaeuk, starting at 12/16/2024 04:55:41
2024-12-16 05:00:51 INFO:	[metaeuk]	1 of 1 task(s) completed
2024-12-16 05:00:51 INFO:	***** Run HMMER on gene sequences *****
2024-12-16 05:00:51 INFO:	Running 3354 job(s) on hmmsearch, starting at 12/16/2024 05:00:51
2024-12-16 05:01:03 INFO:	[hmmsearch]	336 of 3354 task(s) completed
2024-12-16 05:01:14 INFO:	[hmmsearch]	671 of 3354 task(s) completed
2024-12-16 05:01:26 INFO:	[hmmsearch]	1007 of 3354 task(s) completed
2024-12-16 05:01:37 INFO:	[hmmsearch]	1342 of 3354 task(s) completed
2024-12-16 05:01:46 INFO:	[hmmsearch]	1677 of 3354 task(s) completed
2024-12-16 05:01:56 INFO:	[hmmsearch]	2013 of 3354 task(s) completed
2024-12-16 05:02:07 INFO:	[hmmsearch]	2348 of 3354 task(s) completed
2024-12-16 05:02:16 INFO:	[hmmsearch]	2684 of 3354 task(s) completed
2024-12-16 05:02:38 INFO:	[hmmsearch]	3019 of 3354 task(s) completed
2024-12-16 05:03:09 INFO:	[hmmsearch]	3354 of 3354 task(s) completed
2024-12-16 05:03:09 INFO:	59 exons in total
2024-12-16 05:03:10 INFO:	Extracting missing and fragmented buscos from the file refseq_db.faa...
2024-12-16 05:04:58 INFO:	Running 1 job(s) on metaeuk, starting at 12/16/2024 05:04:58
2024-12-16 05:12:57 INFO:	[metaeuk]	1 of 1 task(s) completed
2024-12-16 05:12:57 INFO:	***** Run HMMER on gene sequences *****
2024-12-16 05:12:57 INFO:	Running 3314 job(s) on hmmsearch, starting at 12/16/2024 05:12:57
2024-12-16 05:13:01 INFO:	[hmmsearch]	332 of 3314 task(s) completed
2024-12-16 05:13:05 INFO:	[hmmsearch]	663 of 3314 task(s) completed
2024-12-16 05:13:08 INFO:	[hmmsearch]	995 of 3314 task(s) completed
2024-12-16 05:13:11 INFO:	[hmmsearch]	1326 of 3314 task(s) completed
2024-12-16 05:13:15 INFO:	[hmmsearch]	1657 of 3314 task(s) completed
2024-12-16 05:13:19 INFO:	[hmmsearch]	1989 of 3314 task(s) completed
2024-12-16 05:13:22 INFO:	[hmmsearch]	2320 of 3314 task(s) completed
2024-12-16 05:13:26 INFO:	[hmmsearch]	2652 of 3314 task(s) completed
2024-12-16 05:13:29 INFO:	[hmmsearch]	2983 of 3314 task(s) completed
2024-12-16 05:13:33 INFO:	[hmmsearch]	3314 of 3314 task(s) completed
2024-12-16 05:13:33 INFO:	4 candidate overlapping regions found
2024-12-16 05:13:33 INFO:	65 exons in total
2024-12-16 05:13:33 INFO:	Results:	C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354	   

2024-12-16 05:13:34 INFO:	

    ---------------------------------------------------
    |Results from dataset vertebrata_odb10             |
    ---------------------------------------------------
    |C:1.2%[S:1.2%,D:0.0%],F:0.4%,M:98.4%,n:3354       |
    |40    Complete BUSCOs (C)                         |
    |39    Complete and single-copy BUSCOs (S)         |
    |1    Complete and duplicated BUSCOs (D)           |
    |15    Fragmented BUSCOs (F)                       |
    |3299    Missing BUSCOs (M)                        |
    |3354    Total BUSCO groups searched               |
    ---------------------------------------------------
2024-12-16 05:13:34 INFO:	BUSCO analysis done with WARNING(s). Total running time: 1074 seconds

***** Summary of warnings: *****
2024-12-16 04:55:39 WARNING:busco.BuscoConfig	Option evalue was provided but is not used in the selected run mode, euk_genome_met
2024-12-16 04:55:39 WARNING:busco.BuscoConfig	Option limit was provided but is not used in the selected run mode, euk_genome_met

2024-12-16 05:13:34 INFO:	Results written in /tmp/tmpb1mrmk_7/job_working_directory/000/27/working/busco_galaxy
2024-12-16 05:13:34 INFO:	For assistance with interpreting the results, please consult the userguide: https://busco.ezlab.org/busco_userguide.html

2024-12-16 05:13:34 INFO:	Visit this page https://gitlab.com/ezlab/busco#how-to-cite-busco to see how to cite BUSCO
total 140
drwxr-xr-x 5 1001 118  4096 Dec 16 04:55 busco_sequences
-rw-r--r-- 1 1001 118 76855 Dec 16 05:13 full_table.tsv
drwxr-xr-x 4 1001 118  4096 Dec 16 05:03 hmmer_output
drwxr-xr-x 4 1001 118  4096 Dec 16 05:13 metaeuk_output
-rw-r--r-- 1 1001 118 42328 Dec 16 05:13 missing_busco_list.tsv
-rw-r--r-- 1 1001 118  2953 Dec 16 05:13 short_summary.json
-rw-r--r-- 1 1001 118   969 Dec 16 05:13 short_summary.txt
2024-12-16 05:13:34 INFO:	****************** Start plot generation at 12/16/2024 05:13:34 ******************
2024-12-16 05:13:34 INFO:	Load data ...
2024-12-16 05:13:34 INFO:	Loaded BUSCO_summaries/short_summary.specific.vertebrata_odb10.busco_galaxy.txt successfully
2024-12-16 05:13:34 INFO:	Generate the R code ...
2024-12-16 05:13:34 INFO:	Run the R code ...
2024-12-16 05:13:36 INFO:	
[1] "Plotting the figure ..."
[1] "Done"

2024-12-16 05:13:36 INFO:	Plot generation done. Total running time: 1.9713163375854492 seconds
2024-12-16 05:13:36 INFO:	Results written in BUSCO_summaries/

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
adv	`{"contig_break": "10", "evalue": "0.001", "limit": "3"}`
busco_mode	`{"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 0, "use_augustus_selector": "metaeuk"}}`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
lineage	`{"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"}`
lineage_conditional	`{"__current_case__": 0, "cached_db": "v5", "selector": "cached"}`
outputs	`["short_summary", "missing", "image", "gff"]`

Step 35: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpb1mrmk_7/files/a/3/3/dataset_a33b1bc4-3d4c-482a-b981-f5fc9a62b2ba.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpb1mrmk_7/files/3/c/5/dataset_3c5f52df-9e1b-4009-ba59-9112e1b6d028.dat' assembly_01.fasta && ln -s '/tmp/tmpb1mrmk_7/files/c/7/6/dataset_c76b7a37-9513-4ac1-8705-88621404f718.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpb1mrmk_7/job_working_directory/000/28/outputs/dataset_b93d6a39-f3a6-4f93-acdd-99d825a9f981.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
label	`"output_merqury"`
mode	`{"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 28, "src": "hda"}]}, "assembly_02": {"values": [{"id": 29, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 1, "src": "hda"}]}, "options": "default"}`
output_add_headers	`true`
output_selector	`["qv", "plots", "stats", "log", "hist"]`

Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb1mrmk_7/job_working_directory/000/29/configs/tmp_dl96iie' '/tmp/tmpb1mrmk_7/files/b/8/4/dataset_b84ee980-3d44-47a4-8fcf-0d5b46205402.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/29/outputs/dataset_c28d6fb2-e3d5-4836-8f30-7c2f55cd1824.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\tPrimary\"}; {print}; \n"`
dbkey	`"?"`

Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb1mrmk_7/job_working_directory/000/30/configs/tmp9_z07jqx' '/tmp/tmpb1mrmk_7/files/f/5/5/dataset_f555913d-19c0-4e07-8cbe-b5adbdbd7344.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/30/outputs/dataset_47cdb60e-0400-46e1-bc05-b23c04a39d8c.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"BEGIN{print \"Metric\\tAlternate\"}; {print}; \n"`
dbkey	`"?"`

Step 38: Data Prep Primary:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpb1mrmk_7/files/2/a/c/dataset_2acfea30-53d7-4cef-8676-81fbf05f19a9.dat' --output='/tmp/tmpb1mrmk_7/job_working_directory/000/31/outputs/dataset_caa8fc84-15e1-49d3-b4ce-9e973277fea8.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb1mrmk_7/job_working_directory/000/32/configs/tmp5meqewh5' '/tmp/tmpb1mrmk_7/files/c/a/a/dataset_caa8fc84-15e1-49d3-b4ce-9e973277fea8.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/32/outputs/dataset_36d3d662-ab56-4310-9033-29f2297471a1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpb1mrmk_7/files/3/6/d/dataset_36d3d662-ab56-4310-9033-29f2297471a1.dat > '/tmp/tmpb1mrmk_7/job_working_directory/000/33/outputs/dataset_b04a46b3-1000-4211-af3e-55461a80c9d4.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb1mrmk_7/files/3/6/d/dataset_36d3d662-ab56-4310-9033-29f2297471a1.dat" "/tmp/tmpb1mrmk_7/job_working_directory/000/34/outputs/dataset_878a1d73-492d-4295-b8ec-fadd4f2baf94.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "2052441", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpb1mrmk_7/job_working_directory/000/51/configs/tmpfp11z40q' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb1mrmk_7/files/8/7/8/dataset_878a1d73-492d-4295-b8ec-fadd4f2baf94.dat' '/tmp/tmpb1mrmk_7/job_working_directory/000/51/outputs/dataset_f529e0ae-80ec-4d5d-8131-119ef20859c5.dat'

Exit Code:

```
0
```

Standard Output:

c3/2052441
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/2052441;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 84 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb9bb6811ef899e0022484ff216"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/2052441"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 39: Data Prep Alternate:

step_state: scheduled

Subworkflow Steps

Step 1: gfa_stats:
- step_state: scheduled

Step 2: sort1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpb1mrmk_7/files/9/d/6/dataset_9d6a9ffe-a0b8-4693-aacc-27f49cbff56c.dat' --output='/tmp/tmpb1mrmk_7/job_working_directory/000/36/outputs/dataset_8d10c96f-ec84-4594-9a09-75ffcd40699f.dat'    --key=2,2nr   --header 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
column	`"2"`
column_set	`[]`
dbkey	`"?"`
header_lines	`"0"`
order	`"DESC"`
style	`"num"`

Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

env -i $(which awk) --sandbox -v FS='	' -v OFS='	' --re-interval -f '/tmp/tmpb1mrmk_7/job_working_directory/000/37/configs/tmpzarki2mb' '/tmp/tmpb1mrmk_7/files/8/d/1/dataset_8d10c96f-ec84-4594-9a09-75ffcd40699f.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/37/outputs/dataset_5ccfd074-193e-4382-bb0d-1dba40edc8b1.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
code	`"{total += $2; $3 = total}1"`
dbkey	`"?"`

Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash_ops/datamash_ops/1.8+galaxy0:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

datamash         absmax 3 < /tmp/tmpb1mrmk_7/files/5/c/c/dataset_5ccfd074-193e-4382-bb0d-1dba40edc8b1.dat > '/tmp/tmpb1mrmk_7/job_working_directory/000/38/outputs/dataset_30943757-45ed-41cf-bb2d-ae8e5c3dea43.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
grouping	`""`
header_in	`false`
header_out	`false`
ignore_case	`false`
narm	`false`
need_sort	`false`
operations	`[{"__index__": 0, "op_column": "3", "op_name": "absmax"}]`
print_full_line	`false`

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb1mrmk_7/files/5/c/c/dataset_5ccfd074-193e-4382-bb0d-1dba40edc8b1.dat" "/tmp/tmpb1mrmk_7/job_working_directory/000/39/outputs/dataset_dd2ebb2a-9b44-4da0-9f17-a4a323e29264.dat" "1" "yes"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"1"`
iterate	`"yes"`

Step 6: param_value_from_file:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
param_type	`"integer"`
remove_newlines	`true`

Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

```
cd ../; python _evaluate_expression_.py
```

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
components	`[{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "34014", "select_param_type": "integer"}}]`
dbkey	`"?"`

Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column_maker/Add_a_column1/2.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpb1mrmk_7/job_working_directory/000/52/configs/tmpulepsjb6' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpb1mrmk_7/files/d/d/2/dataset_dd2ebb2a-9b44-4da0-9f17-a4a323e29264.dat' '/tmp/tmpb1mrmk_7/job_working_directory/000/52/outputs/dataset_92ed3a28-ef7c-473c-a5c9-146108384e68.dat'

Exit Code:

```
0
```

Standard Output:

c3/34014
c2/1000000
c3/1000000
Computing 3 new columns with instructions ['c3/34014;;', 'c2/1000000;;', 'c3/1000000;;']
Computed new column values for 100.00% of 3 lines written.

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebabb6811ef899e0022484ff216"`
avoid_scientific_notation	`false`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
error_handling	`{"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}}`
ops	`{"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/34014"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"}`

Step 40: merqury_qv:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
input	`{"values": [{"id": 6, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"}`

Step 5: Homozygous Read Coverage:
- step_state: scheduled

Step 41: output_merqury.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 42: output_merqury.spectra-asm.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"}`

Step 43: output_merqury.assembly_01.spectra-cn.fl:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
input	`{"values": [{"id": 7, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"}`

Step 44: merqury_stats:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Traceback:

Job Parameters:

Job parameter	Parameter value
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
input	`{"values": [{"id": 8, "src": "hdca"}]}`
which	`{"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"}`

Step 45: join1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

python '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/join.py' '/tmp/tmpb1mrmk_7/files/c/2/8/dataset_c28d6fb2-e3d5-4836-8f30-7c2f55cd1824.dat' '/tmp/tmpb1mrmk_7/files/4/7/c/dataset_47cdb60e-0400-46e1-bc05-b23c04a39d8c.dat' 1 1 '/tmp/tmpb1mrmk_7/job_working_directory/000/41/outputs/dataset_3eab2250-9a7c-474d-bef5-f27cf6ad3f45.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpb1mrmk_7/job_working_directory/000/41/configs/tmpze29we53

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
field1	`"1"`
field2	`"1"`
fill_empty_columns	`{"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"}`
header	`""`
partial	`"-p"`
unmatched	`"-u"`

Step 46: Plotting Nx and Sizes:

step_state: scheduled

Subworkflow Steps

Step 1: Primary data:
- step_state: scheduled
Step 2: Alternate data:
- step_state: scheduled

Step 11: Size Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb1mrmk_7/job_working_directory/000/59/configs/tmpct9w0sjz' && Rscript '/tmp/tmpb1mrmk_7/job_working_directory/000/59/configs/tmpct9w0sjz'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpb1mrmk_7/files/5/0/d/dataset_50d773d6-80a1-46b6-ad99-6114f489fd98.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpb1mrmk_7/job_working_directory/000/59/outputs/dataset_6b4fadf7-7301-4f29-bedc-27c62f909e72.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"Scaffold number"`
xplot	`"2"`
ylab	`"Cumulative Size (Mb)"`
yplot	`"3"`

Step 3: Name of primary assembly:
- step_state: scheduled
Step 4: Name of alternate assembly:
- step_state: scheduled

Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb1mrmk_7/files/f/5/2/dataset_f529e0ae-80ec-4d5d-8131-119ef20859c5.dat" "/tmp/tmpb1mrmk_7/job_working_directory/000/53/outputs/dataset_b012ffad-ca26-4794-8e94-870f771e9f34.dat" "Primary" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Primary"`
iterate	`"no"`

Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add_value/addValue/1.0.1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpb1mrmk_7/files/9/2/e/dataset_92ed3a28-ef7c-473c-a5c9-146108384e68.dat" "/tmp/tmpb1mrmk_7/job_working_directory/000/54/outputs/dataset_8c0e40d2-b7ed-4acf-a7fd-393bf0b658a4.dat" "Alternate" "no"

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
exp	`"Alternate"`
iterate	`"no"`

Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cat/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb1mrmk_7/files/b/0/1/dataset_b012ffad-ca26-4794-8e94-870f771e9f34.dat' >> '/tmp/tmpb1mrmk_7/job_working_directory/000/55/outputs/dataset_a663bfef-0a17-41e8-9db4-f9f9029cad9f.dat' && cat '/tmp/tmpb1mrmk_7/files/8/c/0/dataset_8c0e40d2-b7ed-4acf-a7fd-393bf0b658a4.dat' >> '/tmp/tmpb1mrmk_7/job_working_directory/000/55/outputs/dataset_a663bfef-0a17-41e8-9db4-f9f9029cad9f.dat' && exit 0

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
queries	`[{"__index__": 0, "inputs2": {"values": [{"id": 90, "src": "hda"}]}}]`

Step 8: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb1mrmk_7/files/a/6/6/dataset_a663bfef-0a17-41e8-9db4-f9f9029cad9f.dat' 'c8,c5,c6' T '/tmp/tmpb1mrmk_7/job_working_directory/000/56/outputs/dataset_5e0ad8fe-68b8-44df-a906-eaf42a385ecb.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c5,c6"`
dbkey	`"?"`
delimiter	`"T"`

Step 9: Cut1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/tmpb1mrmk_7/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpb1mrmk_7/files/a/6/6/dataset_a663bfef-0a17-41e8-9db4-f9f9029cad9f.dat' 'c8,c4,c7' T '/tmp/tmpb1mrmk_7/job_working_directory/000/57/outputs/dataset_50d773d6-80a1-46b6-ad99-6114f489fd98.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"tabular"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
columnList	`"c8,c4,c7"`
dbkey	`"?"`
delimiter	`"T"`

Step 10: Nx Plot:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cat '/tmp/tmpb1mrmk_7/job_working_directory/000/58/configs/tmp7vsmr3v6' && Rscript '/tmp/tmpb1mrmk_7/job_working_directory/000/58/configs/tmp7vsmr3v6'

Exit Code:

```
0
```

Standard Error:

Warning message:
In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
  OS reports request to set locale to "en_US.UTF-8" cannot be honored
Warning message:
package ‘ggplot2’ was built under R version 4.1.3 
Warning message:
Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.

Standard Output:

        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
    

library(ggplot2)


        #Choose between automatically scaled x and y axis or user defined
            gg_scalex = NULL
            gg_scaley = NULL
    


            gg_theme = theme_bw()
    


            gg_legend = theme(legend.position="right")
    

input <- read.csv('/tmp/tmpb1mrmk_7/files/5/e/0/dataset_5e0ad8fe-68b8-44df-a906-eaf42a385ecb.dat', sep='\t', header=TRUE)

names(input)[2] <- "xcol"
names(input)[3] <- "ycol"

    gg_facet = NULL
    gg_factor = aes(colour=factor(factor))

        gg_line = geom_line(size=1, alpha=1, gg_factor)

        color_scale = scale_color_brewer(palette='Set1', direction='1')

    names(input)[1] <- "factor"


    

    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

    gg_gridline = NULL

    gg_point = NULL

#this is the actual ggplot command to make the final plot(s)
plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline


        gg_width <- as.double('6.0')
        gg_height <- as.double('4.0')
        gg_unit <- 'in'
        gg_dpi <- as.double('300.0')
        gg_add_device <- 'none'
        output1 <- '/tmp/tmpb1mrmk_7/job_working_directory/000/58/outputs/dataset_a1372175-19c2-4262-8bee-17252fd11a1d.dat'
        output2 <- 'XXXX'

        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
        if(gg_add_device != "none"){
          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
        }

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96ebbbb6811ef899e0022484ff216"`
adv	{"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}}
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
out	`{"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"}`
title	`""`
xlab	`"x"`
xplot	`"2"`
ylab	`"Nx (Mb)"`
yplot	`"3"`

Step 47: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_cut_tool/9.3+galaxy2:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

cut --complement -f '3' '/tmp/tmpb1mrmk_7/files/3/e/a/dataset_3eab2250-9a7c-474d-bef5-f27cf6ad3f45.dat' > '/tmp/tmpb1mrmk_7/job_working_directory/000/42/outputs/dataset_48564299-f732-4b67-b96d-50faf546ed65.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
complement	`"--complement"`
cut_type_options	`{"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""}`
dbkey	`"?"`

Step 48: toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_find_and_replace/9.3+galaxy1:

step_state: scheduled

Jobs

Job 1:

Job state is ok

Command Line:

perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpb1mrmk_7/job_working_directory/000/43/outputs/dataset_268eb7e0-29c0-4e6d-9cb3-62f5fbccd2e3.dat' -g     '#' 'Number of' '/tmp/tmpb1mrmk_7/files/4/8/5/dataset_48564299-f732-4b67-b96d-50faf546ed65.dat'

Exit Code:

```
0
```

Traceback:

Job Parameters:

Job parameter	Parameter value
__input_ext	`"input"`
__workflow_invocation_uuid__	`"fba96eb8bb6811ef899e0022484ff216"`
chromInfo	`"/tmp/tmpb1mrmk_7/galaxy-dev/tool-data/shared/ucsc/chrom/?.len"`
dbkey	`"?"`
find_and_replace	`[{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}]`

Step 6: Genomescope Model Parameters:
- step_state: scheduled
Step 7: Database for Busco Lineage:
- step_state: scheduled
Step 8: Lineage:
- step_state: scheduled
Step 9: SAK input file (Optional):
- step_state: scheduled
Step 10: Name of primary assembly:
- step_state: scheduled

Other invocation details
- history_id
  - a4c4122cc2176a16
- history_state
  - ok
- invocation_id
  - a4c4122cc2176a16
- invocation_state
  - scheduled
- workflow_id
  - 19abed743b145cf2

Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2…

2c427fc

… to 0.2.3

gxydevbot changed the title ~~Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3~~ Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 Dec 16, 2024

gxydevbot force-pushed the workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 branch from 54e5f3e to 2c427fc Compare December 16, 2024 04:35

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 #624

Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 #624

gxydevbot commented Dec 9, 2024

github-actions bot commented Dec 9, 2024

Workflow invocation details

gxydevbot commented Dec 16, 2024

github-actions bot commented Dec 16, 2024

Workflow invocation details

Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 #624

Are you sure you want to change the base?

Updating workflows/VGP-assembly-v2/Assembly-Hifi-only-VGP3 from 0.2.2 to 0.2.3 #624

Conversation

gxydevbot commented Dec 9, 2024

github-actions bot commented Dec 9, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details

gxydevbot commented Dec 16, 2024

github-actions bot commented Dec 16, 2024

Test Results (powered by Planemo)

Test Summary

Workflow invocation details