Joint Junction Mutation and Repeat Expansion Interpretation

[zahraa992]

Hi,

A gene has acquired a joint junction mutation at position 1610595, as identified by breseq. According to the reference sequence of that gene the sequence between 1610488 and 1610595 contains four out of seven repeats of the sequence 'GAAGATGGCTACTAAGGAAGACCTCCA'.

I assumed that if a new junction occurred, I would find the remaining three repeats of the seven in the newly joined sequence. However, I was unable to find the remaining repeats in the new joint sequence. Additionally, I could not match any part of the newly joined sequence to the reference genome.

My question is: Why did breseq report this mutation as "(GAAGATGGCTACTAAGGAAGACCTCCA)4→8"? Could this be a misinterpretation by breseq? And what might have actually happened to the remaining repeats?

the mutation:

part of the newly joint sequence

Thank you in advance,

[jeffreybarrick]

This junction is consistent with 4 additional copies of the 27-bp repeat being added. Its frequency is at 57%, but it is in some kind of repeat region, so it seems plausible that one of the two copies in the reference has mutated in this way.

It looks like breseq was not able to recognize that there were an additional three copies in the reference already in addition to the four it reports as changing there in the reference. I agree that it should start at at 7 copies instead of 4 copies.

Therefore, I think the mutation should probably be output as (GAAGATGGCTACTAAGGAAGACCTCCA)7→11

Can you share the reads and reference genome with me by emailing the address in the breseq header? (I can set up a shared folder for upload if helpful.) That will let me investigate where the logic is off in how it is counting the repeat units.