diff --git a/README b/README
index ecaea7e..501c03c 100644
--- a/README
+++ b/README
@@ -1,9 +1,17 @@
 BioUtil
 
-BioUtil - My Bioinformatics Utilities!
+BioUtil - Bioinformatics Utilities!
+
 https://github.com/shenwei356/BioUtil
+http://search.cpan.org/dist/BioUtil/
+
+Some great modules like BioPerl provide many robust solutions. 
+However, it is not easy to install for someone in some platforms.
+And for some simple task scripts, a lite module may be a good choice.
+So I reinvented some wheels and added some useful utilities into this module,
+hoping it would be helpful.
 
-Please check the submodules.
+Please check the docments of submodules.
 
 
 INSTALLATION
diff --git a/lib/BioUtil.pm b/lib/BioUtil.pm
index 6ea7787..6efc639 100644
--- a/lib/BioUtil.pm
+++ b/lib/BioUtil.pm
@@ -6,17 +6,23 @@ use warnings FATAL => 'all';
 
 =head1 NAME
 
-BioUtil - My Bioinformatics Utilities!
+BioUtil - Bioinformatics Utilities!
+
+Some great modules like BioPerl provide many robust solutions. 
+However, it is not easy to install for someone in some platforms.
+And for some simple task scripts, a lite module may be a good choice.
+So I reinvented some wheels and added some useful utilities into this module,
+hoping it would be helpful.
 
 Please check the submodules.
 
 =head1 VERSION
 
-Version 2014.0814
+Version 2014.0815
 
 =cut
 
-our $VERSION = 2014.0814;
+our $VERSION = 2014.0815;
 
 
 =head1 AUTHOR
diff --git a/lib/BioUtil/Seq.pm b/lib/BioUtil/Seq.pm
index 93b30dd..c84091d 100644
--- a/lib/BioUtil/Seq.pm
+++ b/lib/BioUtil/Seq.pm
@@ -32,6 +32,12 @@ use List::Util qw(shuffle);
 
 BioUtil::Seq - Utilities for sequence
 
+Some great modules like BioPerl provide many robust solutions. 
+However, it is not easy to install for someone in some platforms.
+And for some simple task scripts, a lite module may be a good choice.
+So I reinvented some wheels and added some useful utilities into this module,
+hoping it would be helpful.
+
 =head1 VERSION
 
 Version 2014.0814
diff --git a/lib/BioUtil/Util.pm b/lib/BioUtil/Util.pm
index 5533ed8..84c3ae9 100644
--- a/lib/BioUtil/Util.pm
+++ b/lib/BioUtil/Util.pm
@@ -28,15 +28,21 @@ use JSON;
 
 =head1 NAME
 
-BioUtil::Seq - Utilities for operation on data or file
+BioUtil::Util - Utilities for operation on data or file
+
+Some great modules like BioPerl provide many robust solutions. 
+However, it is not easy to install for someone in some platforms.
+And for some simple task scripts, a lite module may be a good choice.
+So I reinvented some wheels and added some useful utilities into this module,
+hoping it would be helpful.
 
 =head1 VERSION
 
-Version 2014.0814
+Version 2014.0815
 
 =cut
 
-our $VERSION = 2014.0814;
+our $VERSION = 2014.0815;
 
 =head1 EXPORT
 
diff --git a/t/seq2.fa b/t/seq2.fa
index beccbdc..c78b14e 100644
--- a/t/seq2.fa
+++ b/t/seq2.fa
@@ -1,6 +1,6 @@
->seq2
-aaaaaacccccgggggttttt
-
 >seq1<test>
 aaaaaccccggggtttt
 
+>seq2
+aaaaaacccccgggggttttt
+
diff --git a/t/test.json b/t/test.json
index be93d58..72af223 100644
--- a/t/test.json
+++ b/t/test.json
@@ -1,4 +1,4 @@
 {
-   "b" : 2,
-   "a" : 1
+   "a" : 1,
+   "b" : 2
 }