From eedabad0b1b8a019ceead851b8e7c09912ac8f72 Mon Sep 17 00:00:00 2001 From: Elizabeth Kiernan <55763654+ekiernan@users.noreply.github.com> Date: Tue, 21 Jan 2025 14:39:29 -0500 Subject: [PATCH] adding Paired-tag EM multimapping and csi index output (#1482) added EM multimapping and csi index output to PairedTag WDL --- pipeline_versions.txt | 6 +++--- pipelines/skylab/atac/atac.changelog.md | 5 +++-- pipelines/skylab/atac/atac.wdl | 4 +++- pipelines/skylab/multiome/Multiome.changelog.md | 5 +++-- pipelines/skylab/multiome/Multiome.wdl | 2 +- pipelines/skylab/paired_tag/PairedTag.changelog.md | 6 ++++-- pipelines/skylab/paired_tag/PairedTag.wdl | 6 ++++-- 7 files changed, 21 insertions(+), 13 deletions(-) diff --git a/pipeline_versions.txt b/pipeline_versions.txt index 999efa98c8..85b1dbb384 100644 --- a/pipeline_versions.txt +++ b/pipeline_versions.txt @@ -27,12 +27,12 @@ BroadInternalImputation 1.1.14 2024-11-04 BroadInternalArrays 1.1.14 2024-11-04 BroadInternalRNAWithUMIs 1.0.36 2024-11-04 RNAWithUMIsPipeline 1.0.18 2024-11-04 -Multiome 5.9.5 2025-01-13 +Multiome 5.9.6 2025-01-21 MultiSampleSmartSeq2SingleNucleus 2.0.7 2025-01-13 BuildIndices 4.0.0 2025-01-17 SlideSeq 3.4.8 2025-01-13 -PairedTag 1.9.1 2025-01-13 -atac 2.5.4 2025-01-13 +PairedTag 1.10.0 2025-01-21 +atac 2.6.0 2025-01-21 scATAC 1.3.2 2023-08-03 snm3C 4.0.4 2024-08-06 Optimus 7.9.1 2025-01-13 diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md index 074e2e3614..d47665f255 100644 --- a/pipelines/skylab/atac/atac.changelog.md +++ b/pipelines/skylab/atac/atac.changelog.md @@ -1,7 +1,8 @@ -# 2.5.4 -2025-01-13 (Date of Last Commit) +# 2.6.0 +2025-01-21 (Date of Last Commit) * Added reference_gtf_file to the output h5ad unstructured metadata +* Added the fragment file CSI index as a workflow output # 2.5.3 2024-11-22 (Date of Last Commit) diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl index 32a06b6951..9771e753cc 100644 --- a/pipelines/skylab/atac/atac.wdl +++ b/pipelines/skylab/atac/atac.wdl @@ -49,7 +49,7 @@ workflow ATAC { String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG" } - String pipeline_version = "2.5.4" + String pipeline_version = "2.6.0" # Determine docker prefix based on cloud provider String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/" @@ -164,12 +164,14 @@ workflow ATAC { File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output]) File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file]) + File fragment_file_index_atac = select_first([BB_fragment.fragment_file_index, CreateFragmentFile.fragment_file_index]) File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics]) File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics]) output { File bam_aligned_output = bam_aligned_output_atac File fragment_file = fragment_file_atac + File fragment_file_index = fragment_file_index_atac File snap_metrics = snap_metrics_atac File library_metrics_file = library_metrics } diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md index 42b92421f5..c73565dbbc 100644 --- a/pipelines/skylab/multiome/Multiome.changelog.md +++ b/pipelines/skylab/multiome/Multiome.changelog.md @@ -1,8 +1,9 @@ -# 5.9.5 -2025-01-13 (Date of Last Commit) +# 5.9.6 +2025-01-21 (Date of Last Commit) * Added a boolean variable is_slidetags; default is false but it is set to true if the Slide-Tags pipeline is calling Optimus * Added reference_gtf_file to the output h5ad unstructured metadata +* Added the ATAC fragment file CSI index as high-level ATAC workflow output; this does not impact the Multiome workflow as Multiome already produces the csi index from ATAC # 5.9.4 2024-12-05 (Date of Last Commit) diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl index 1553513fd7..1ed1108f07 100644 --- a/pipelines/skylab/multiome/Multiome.wdl +++ b/pipelines/skylab/multiome/Multiome.wdl @@ -7,7 +7,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils workflow Multiome { - String pipeline_version = "5.9.5" + String pipeline_version = "5.9.6" input { String cloud_provider diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md index 1b272008cd..d26db399ff 100644 --- a/pipelines/skylab/paired_tag/PairedTag.changelog.md +++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md @@ -1,8 +1,10 @@ -# 1.9.1 -2025-01-13 (Date of Last Commit) +# 1.10.0 +2025-01-21 (Date of Last Commit) * Added a boolean variable is_slidetags; default is false, but set to true if Slide-Tags pipeline is calling Optimus * Added reference_gtf_file to the output h5ad unstructured metadata +* Added the fragment file CSI index as workflow output +* Updated the default STARsolo multimapping parameter to the "EM" tehcnique # 1.9.0 2024-12-05 (Date of Last Commit) diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl index a31d3c5944..fdf942bf90 100644 --- a/pipelines/skylab/paired_tag/PairedTag.wdl +++ b/pipelines/skylab/paired_tag/PairedTag.wdl @@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils workflow PairedTag { - String pipeline_version = "1.9.1" + String pipeline_version = "1.10.0" input { @@ -33,7 +33,7 @@ workflow PairedTag { Boolean count_exons = false File gex_whitelist = if cloud_provider == "gcp" then "gs://gcp-public-data--broad-references/RNA/resources/arc-v1/737K-arc-v1_gex.txt" else "https://datasetpublicbroadref.blob.core.windows.net/dataset/RNA/resources/arc-v1/737K-arc-v1_gex.txt?sv=2020-04-08&si=prod&sr=c&sig=DQxmjB4D1lAfOW9AxIWbXwZx6ksbwjlNkixw597JnvQ%3D" - String? soloMultiMappers = "Uniform" + String? soloMultiMappers = "EM" # ATAC inputs # Array of input fastq files Array[File] atac_r1_fastq @@ -153,6 +153,7 @@ workflow PairedTag { } File atac_fragment_out = select_first([ParseBarcodes.atac_fragment_tsv,Atac_preindex.fragment_file]) + File atac_fragment_index_out = select_first([ParseBarcodes.atac_fragment_tsv_tbi,Atac_preindex.fragment_file_index]) File atac_h5ad_out = select_first([ParseBarcodes.atac_h5ad_file, Atac_preindex.snap_metrics]) output { @@ -164,6 +165,7 @@ workflow PairedTag { File fragment_file_atac = atac_fragment_out File snap_metrics_atac = atac_h5ad_out File atac_library_final = Atac_preindex.library_metrics_file + File fragment_file_index_atac = atac_fragment_index_out # optimus outputs File genomic_reference_version_gex = Optimus.genomic_reference_version