From e1ddfeed4ce38975b59d804258893fec48439b18 Mon Sep 17 00:00:00 2001 From: Steve Wooster Date: Tue, 17 Oct 2023 22:19:16 -0700 Subject: [PATCH 1/3] Add ability to find canonical substitution of DNA --- Cargo.toml | 4 + benches/canonical.rs | 62 +++++++ src/canonical.rs | 421 +++++++++++++++++++++++++++++++++++++++++++ src/lib.rs | 4 +- src/rust_api.rs | 11 ++ 5 files changed, 501 insertions(+), 1 deletion(-) create mode 100644 benches/canonical.rs create mode 100644 src/canonical.rs diff --git a/Cargo.toml b/Cargo.toml index ac35691..0af7e67 100644 --- a/Cargo.toml +++ b/Cargo.toml @@ -16,6 +16,7 @@ serde = {version = "1.0", features = ["derive"], optional = true} [dev-dependencies] criterion = "0.5.1" +quickcheck = "1.0.3" rand = "0.8.5" serde_json = "1" @@ -32,6 +33,9 @@ default = ["python-support"] name = "all_windows" harness = false +[[bench]] +name = "canonical" +harness = false [[bench]] name = "expansions" diff --git a/benches/canonical.rs b/benches/canonical.rs new file mode 100644 index 0000000..f1693dd --- /dev/null +++ b/benches/canonical.rs @@ -0,0 +1,62 @@ +// Copyright 2021-2023 SecureDNA Stiftung (SecureDNA Foundation) +// SPDX-License-Identifier: MIT OR Apache-2.0 + +use std::hint::black_box; + +use criterion::{criterion_group, criterion_main, BenchmarkId, Criterion, Throughput}; +use rand::{rngs::OsRng, seq::SliceRandom}; + +use quickdna::canonical::{Canonical, ForwardCanonical}; +use quickdna::Nucleotide; + +pub fn criterion_benchmark(c: &mut Criterion) { + const NUM_WINDOWS: u64 = 10000; + const WINDOW_LEN: usize = 42; + let dna_len = (NUM_WINDOWS as usize) + WINDOW_LEN - 1; + let dna: Vec<_> = (0..dna_len) + .map(|_| Nucleotide::ALL.choose(&mut OsRng).unwrap()) + .collect(); + + let num_windows_desc = format!("{NUM_WINDOWS} windows"); + + let mut group = c.benchmark_group("canonicalization"); + group.throughput(Throughput::Elements(NUM_WINDOWS)); + group.bench_with_input( + BenchmarkId::new("bidirectional", &num_windows_desc), + &(&dna, WINDOW_LEN), + |b, &(dna, window_len)| { + b.iter(|| { + let canonicalized_windows = dna.windows(window_len).map(|window| { + let mut canonical = Canonical::new(window.iter().copied().copied()); + let window: [_; WINDOW_LEN] = + std::array::from_fn(|_| canonical.next().unwrap()); + window + }); + for window in canonicalized_windows { + black_box(&window); + } + }) + }, + ); + group.bench_with_input( + BenchmarkId::new("forward-only", &num_windows_desc), + &(&dna, WINDOW_LEN), + |b, &(dna, window_len)| { + b.iter(|| { + let canonicalized_windows = dna.windows(window_len).map(|window| { + let mut canonical = ForwardCanonical::new(window.iter().copied().copied()); + let window: [_; WINDOW_LEN] = + std::array::from_fn(|_| canonical.next().unwrap()); + window + }); + for window in canonicalized_windows { + black_box(&window); + } + }) + }, + ); + group.finish(); +} + +criterion_group!(benches, criterion_benchmark); +criterion_main!(benches); diff --git a/src/canonical.rs b/src/canonical.rs new file mode 100644 index 0000000..c364c98 --- /dev/null +++ b/src/canonical.rs @@ -0,0 +1,421 @@ +// Copyright 2021-2023 SecureDNA Stiftung (SecureDNA Foundation) +// SPDX-License-Identifier: MIT OR Apache-2.0 + +use std::cmp::Ordering; + +use crate::Nucleotide; + +/// Permute bases (and maybe reverse sequence) to produce lexical-minimum substitution of DNA. +/// +/// This is similar to [`ForwardCanonical`] except in addition to remapping bases, it may also +/// reverse the original [`Nucleotide`] sequence, if doing so yields a lexically "earlier" +/// [`Nucleotide`] sequence. This means that `AATA` and `TCTT` both have the same canonical +/// sequence. +/// +/// Thus, two [`Nucleotide`] sequence have the same canonical form if-and-only-if one is +/// isomorphic to the other (or its reverse). Canonicalization is idempotent. +#[derive(Clone, Debug)] +pub struct Canonical(LexicalMin, ForwardCanonical>>); + +impl Canonical +where + I: Iterator, +{ + /// Create iter of canonical substition for `iterable` + pub fn new(iterable: impl IntoIterator) -> Self + where + I: DoubleEndedIterator + Clone, + { + let iter = iterable.into_iter(); + let fw_canon = ForwardCanonical::new(iter.clone()); + let rev_canon = ForwardCanonical::new(iter.rev()); + Canonical(LexicalMin::new(fw_canon, rev_canon)) + } +} + +impl Iterator for Canonical +where + I: DoubleEndedIterator, +{ + type Item = Nucleotide; + + #[inline] + fn next(&mut self) -> Option { + self.0.next() + } + + fn size_hint(&self) -> (usize, Option) { + self.0.size_hint() + } +} + +impl ExactSizeIterator for Canonical where + I: ExactSizeIterator + DoubleEndedIterator +{ +} + +/// Permute bases to produce lexical-minimum substitution of DNA. +/// +/// This returns a sequence of [`Nucleotide`]s that is: +/// * Isomorphic to the original sequence; that is, the bases can be remapped to convert between +/// the original and forward-canonnical sequences. So `ATA` and `GAG` have the same +/// forward-canonical sequence but `TAA` and `GAG` do not. +/// * Lexically "before" all other [`Nucleotide`] sequences that are isomorphic to it. Note that +/// (at the time of this writing) the order of [`Nucleotide`]s is +/// [`A`](Nucleotide::A) [`T`](Nucleotide::T) [`C`](Nucleotide::C) [`G`](Nucleotide::G) +/// instead of alphabetical, so the forward-canonical sequence for `CATTAG` is `ATCCTG`, _not_ +/// `ACGGCT`. +/// +/// Thus, two sequences of [`Nucleotide`]s produce the same forward-canonical sequence +/// if-and-only-if they are isomorphic. Forward-canonicalization is idempotent. +#[derive(Clone, Debug)] +pub struct ForwardCanonical { + inner: I, + permutation: [Option; 4], + unmapped: std::slice::Iter<'static, Nucleotide>, +} + +impl ForwardCanonical +where + I: Iterator, +{ + /// Create iter of forward-canonical substition for `iterable` + pub fn new(iterable: impl IntoIterator) -> Self + where + I: Iterator, // Might as well catch type errors early. + { + Self { + inner: iterable.into_iter(), + permutation: [None; 4], + unmapped: Nucleotide::ALL.iter(), + } + } +} + +impl Iterator for ForwardCanonical +where + I: Iterator, +{ + type Item = Nucleotide; + + fn next(&mut self) -> Option { + let idx = match self.inner.next()? { + Nucleotide::A => 0, + Nucleotide::T => 1, + Nucleotide::C => 2, + Nucleotide::G => 3, + }; + let nuc = *self.permutation[idx] + .get_or_insert_with(|| self.unmapped.next().copied().unwrap_or(Nucleotide::A)); + Some(nuc) + } + + fn size_hint(&self) -> (usize, Option) { + self.inner.size_hint() + } +} + +impl> ExactSizeIterator for ForwardCanonical {} + +// Like an allocation-free variant of: +// Vec::from_iter(iter1).min(iter2.collect()).into_iter() +#[derive(Clone, Debug)] +struct LexicalMin { + iter1: I1, + order: Ordering, + iter2: I2, +} + +impl LexicalMin { + fn new(iter1: I1, iter2: I2) -> Self { + Self { + iter1, + order: Ordering::Equal, + iter2, + } + } +} + +impl Iterator for LexicalMin +where + I1: Iterator, + I2: Iterator, + I1::Item: Ord, +{ + type Item = I1::Item; + + #[inline] + fn next(&mut self) -> Option { + match self.order { + Ordering::Less => self.iter1.next(), + Ordering::Equal => { + let item1 = self.iter1.next(); + let item2 = self.iter2.next(); + self.order = item1.cmp(&item2); + if self.order.is_lt() { + item1 + } else { + item2 + } + } + Ordering::Greater => self.iter2.next(), + } + } + + fn size_hint(&self) -> (usize, Option) { + let (min1, max1) = self.iter1.size_hint(); + let (min2, max2) = self.iter2.size_hint(); + let min = min1.min(min2); + let max = max1.zip(max2).map(|(max1, max2)| max1.max(max2)); + (min, max) + } +} + +#[cfg(test)] +mod test { + use super::*; + + use quickcheck::quickcheck; + + use crate::{BaseSequence, DnaSequenceStrict}; + + fn fw_canon(src_dna: &str) -> String { + let dna: DnaSequenceStrict = src_dna.parse().unwrap(); + let canonical = ForwardCanonical::new(dna.iter()).collect(); + DnaSequenceStrict::new(canonical).to_string() + } + + fn canon(src_dna: &str) -> String { + let dna: DnaSequenceStrict = src_dna.parse().unwrap(); + dna.canonical().to_string() + } + + #[test] + fn sanity_check_forward_canonicalization() { + assert_eq!( + fw_canon("TGCGAGTGTAGCGAGATGTAGCGTAGAGTCTGAGATGCAGTA"), + "ATCTGTATAGTCTGTGATAGTCTAGTGTACATGTGATCGTAG" + ); + } + + #[test] + fn sanity_check_canonicalization() { + assert_eq!( + canon("TGCGAGTGTAGCGAGATGTAGCGTAGAGTCTGAGATGCAGTA"), + "ATCAGCTACACTGTCACATCGCATCTACACGCATCTCACGCT" + ); + } + + #[test] + fn exhaustively_check_forward_canonicalization_of_small_dna() { + assert_eq!(fw_canon(""), ""); + + assert_eq!(fw_canon("A"), "A"); + assert_eq!(fw_canon("T"), "A"); + assert_eq!(fw_canon("C"), "A"); + assert_eq!(fw_canon("G"), "A"); + + assert_eq!(fw_canon("AA"), "AA"); + assert_eq!(fw_canon("AT"), "AT"); + assert_eq!(fw_canon("AC"), "AT"); + assert_eq!(fw_canon("AG"), "AT"); + assert_eq!(fw_canon("TA"), "AT"); + assert_eq!(fw_canon("TT"), "AA"); + assert_eq!(fw_canon("TC"), "AT"); + assert_eq!(fw_canon("TG"), "AT"); + assert_eq!(fw_canon("CA"), "AT"); + assert_eq!(fw_canon("CT"), "AT"); + assert_eq!(fw_canon("CC"), "AA"); + assert_eq!(fw_canon("CG"), "AT"); + assert_eq!(fw_canon("GA"), "AT"); + assert_eq!(fw_canon("GT"), "AT"); + assert_eq!(fw_canon("GC"), "AT"); + assert_eq!(fw_canon("GG"), "AA"); + + assert_eq!(fw_canon("AAA"), "AAA"); + assert_eq!(fw_canon("AAT"), "AAT"); + assert_eq!(fw_canon("AAC"), "AAT"); + assert_eq!(fw_canon("AAG"), "AAT"); + assert_eq!(fw_canon("ATA"), "ATA"); + assert_eq!(fw_canon("ATT"), "ATT"); + assert_eq!(fw_canon("ATC"), "ATC"); + assert_eq!(fw_canon("ATG"), "ATC"); + assert_eq!(fw_canon("ACA"), "ATA"); + assert_eq!(fw_canon("ACT"), "ATC"); + assert_eq!(fw_canon("ACC"), "ATT"); + assert_eq!(fw_canon("ACG"), "ATC"); + assert_eq!(fw_canon("AGA"), "ATA"); + assert_eq!(fw_canon("AGT"), "ATC"); + assert_eq!(fw_canon("AGC"), "ATC"); + assert_eq!(fw_canon("AGG"), "ATT"); + + assert_eq!(fw_canon("TAA"), "ATT"); + assert_eq!(fw_canon("TAT"), "ATA"); + assert_eq!(fw_canon("TAC"), "ATC"); + assert_eq!(fw_canon("TAG"), "ATC"); + assert_eq!(fw_canon("TTA"), "AAT"); + assert_eq!(fw_canon("TTT"), "AAA"); + assert_eq!(fw_canon("TTC"), "AAT"); + assert_eq!(fw_canon("TTG"), "AAT"); + assert_eq!(fw_canon("TCA"), "ATC"); + assert_eq!(fw_canon("TCT"), "ATA"); + assert_eq!(fw_canon("TCC"), "ATT"); + assert_eq!(fw_canon("TCG"), "ATC"); + assert_eq!(fw_canon("TGA"), "ATC"); + assert_eq!(fw_canon("TGT"), "ATA"); + assert_eq!(fw_canon("TGC"), "ATC"); + assert_eq!(fw_canon("TGG"), "ATT"); + + assert_eq!(fw_canon("CAA"), "ATT"); + assert_eq!(fw_canon("CAT"), "ATC"); + assert_eq!(fw_canon("CAC"), "ATA"); + assert_eq!(fw_canon("CAG"), "ATC"); + assert_eq!(fw_canon("CTA"), "ATC"); + assert_eq!(fw_canon("CTT"), "ATT"); + assert_eq!(fw_canon("CTC"), "ATA"); + assert_eq!(fw_canon("CTG"), "ATC"); + assert_eq!(fw_canon("CCA"), "AAT"); + assert_eq!(fw_canon("CCT"), "AAT"); + assert_eq!(fw_canon("CCC"), "AAA"); + assert_eq!(fw_canon("CCG"), "AAT"); + assert_eq!(fw_canon("CGA"), "ATC"); + assert_eq!(fw_canon("CGT"), "ATC"); + assert_eq!(fw_canon("CGC"), "ATA"); + assert_eq!(fw_canon("CGG"), "ATT"); + + assert_eq!(fw_canon("GAA"), "ATT"); + assert_eq!(fw_canon("GAT"), "ATC"); + assert_eq!(fw_canon("GAC"), "ATC"); + assert_eq!(fw_canon("GAG"), "ATA"); + assert_eq!(fw_canon("GTA"), "ATC"); + assert_eq!(fw_canon("GTT"), "ATT"); + assert_eq!(fw_canon("GTC"), "ATC"); + assert_eq!(fw_canon("GTG"), "ATA"); + assert_eq!(fw_canon("GCA"), "ATC"); + assert_eq!(fw_canon("GCT"), "ATC"); + assert_eq!(fw_canon("GCC"), "ATT"); + assert_eq!(fw_canon("GCG"), "ATA"); + assert_eq!(fw_canon("GGA"), "AAT"); + assert_eq!(fw_canon("GGT"), "AAT"); + assert_eq!(fw_canon("GGC"), "AAT"); + assert_eq!(fw_canon("GGG"), "AAA"); + } + + #[test] + fn exhaustively_check_canonicalization_of_small_dna() { + assert_eq!(canon(""), ""); + + assert_eq!(canon("A"), "A"); + assert_eq!(canon("T"), "A"); + assert_eq!(canon("C"), "A"); + assert_eq!(canon("G"), "A"); + + assert_eq!(canon("AA"), "AA"); + assert_eq!(canon("AT"), "AT"); + assert_eq!(canon("AC"), "AT"); + assert_eq!(canon("AG"), "AT"); + assert_eq!(canon("TA"), "AT"); + assert_eq!(canon("TT"), "AA"); + assert_eq!(canon("TC"), "AT"); + assert_eq!(canon("TG"), "AT"); + assert_eq!(canon("CA"), "AT"); + assert_eq!(canon("CT"), "AT"); + assert_eq!(canon("CC"), "AA"); + assert_eq!(canon("CG"), "AT"); + assert_eq!(canon("GA"), "AT"); + assert_eq!(canon("GT"), "AT"); + assert_eq!(canon("GC"), "AT"); + assert_eq!(canon("GG"), "AA"); + + assert_eq!(canon("AAA"), "AAA"); + assert_eq!(canon("AAT"), "AAT"); + assert_eq!(canon("AAC"), "AAT"); + assert_eq!(canon("AAG"), "AAT"); + assert_eq!(canon("ATA"), "ATA"); + assert_eq!(canon("ATT"), "AAT"); + assert_eq!(canon("ATC"), "ATC"); + assert_eq!(canon("ATG"), "ATC"); + assert_eq!(canon("ACA"), "ATA"); + assert_eq!(canon("ACT"), "ATC"); + assert_eq!(canon("ACC"), "AAT"); + assert_eq!(canon("ACG"), "ATC"); + assert_eq!(canon("AGA"), "ATA"); + assert_eq!(canon("AGT"), "ATC"); + assert_eq!(canon("AGC"), "ATC"); + assert_eq!(canon("AGG"), "AAT"); + + assert_eq!(canon("TAA"), "AAT"); + assert_eq!(canon("TAT"), "ATA"); + assert_eq!(canon("TAC"), "ATC"); + assert_eq!(canon("TAG"), "ATC"); + assert_eq!(canon("TTA"), "AAT"); + assert_eq!(canon("TTT"), "AAA"); + assert_eq!(canon("TTC"), "AAT"); + assert_eq!(canon("TTG"), "AAT"); + assert_eq!(canon("TCA"), "ATC"); + assert_eq!(canon("TCT"), "ATA"); + assert_eq!(canon("TCC"), "AAT"); + assert_eq!(canon("TCG"), "ATC"); + assert_eq!(canon("TGA"), "ATC"); + assert_eq!(canon("TGT"), "ATA"); + assert_eq!(canon("TGC"), "ATC"); + assert_eq!(canon("TGG"), "AAT"); + + assert_eq!(canon("CAA"), "AAT"); + assert_eq!(canon("CAT"), "ATC"); + assert_eq!(canon("CAC"), "ATA"); + assert_eq!(canon("CAG"), "ATC"); + assert_eq!(canon("CTA"), "ATC"); + assert_eq!(canon("CTT"), "AAT"); + assert_eq!(canon("CTC"), "ATA"); + assert_eq!(canon("CTG"), "ATC"); + assert_eq!(canon("CCA"), "AAT"); + assert_eq!(canon("CCT"), "AAT"); + assert_eq!(canon("CCC"), "AAA"); + assert_eq!(canon("CCG"), "AAT"); + assert_eq!(canon("CGA"), "ATC"); + assert_eq!(canon("CGT"), "ATC"); + assert_eq!(canon("CGC"), "ATA"); + assert_eq!(canon("CGG"), "AAT"); + + assert_eq!(canon("GAA"), "AAT"); + assert_eq!(canon("GAT"), "ATC"); + assert_eq!(canon("GAC"), "ATC"); + assert_eq!(canon("GAG"), "ATA"); + assert_eq!(canon("GTA"), "ATC"); + assert_eq!(canon("GTT"), "AAT"); + assert_eq!(canon("GTC"), "ATC"); + assert_eq!(canon("GTG"), "ATA"); + assert_eq!(canon("GCA"), "ATC"); + assert_eq!(canon("GCT"), "ATC"); + assert_eq!(canon("GCC"), "AAT"); + assert_eq!(canon("GCG"), "ATA"); + assert_eq!(canon("GGA"), "AAT"); + assert_eq!(canon("GGT"), "AAT"); + assert_eq!(canon("GGC"), "AAT"); + assert_eq!(canon("GGG"), "AAA"); + } + + #[test] + fn canonicalization_selects_reverse_if_that_is_lexically_less() { + assert_eq!(canon("TTGT"), "AATA"); + assert_eq!(canon("TGTT"), "AATA"); + + assert_eq!(canon("ATCGCCAT"), "ATCCGCAT"); + } + + quickcheck! { + fn forward_canonicalization_is_idempotent(dna: DnaSequenceStrict) -> bool { + let canonical = ForwardCanonical::new(dna.as_slice().iter().copied()); + let canonical2 = ForwardCanonical::new(canonical.clone()); + canonical2.eq(canonical) + } + + fn canonicalization_is_idempotent(dna: DnaSequenceStrict) -> bool { + // Need full allocation because canonical needs a double-ended iter, but isn't one itself. + let canonical = dna.canonical(); + let canonical2 = canonical.canonical(); + canonical2 == canonical + } + } +} diff --git a/src/lib.rs b/src/lib.rs index cacf280..08314b3 100644 --- a/src/lib.rs +++ b/src/lib.rs @@ -8,6 +8,8 @@ mod errors; mod nucleotide; pub mod trans_table; // needs to be public for bin/gen_table +pub mod canonical; + mod extendable; pub use extendable::*; @@ -28,7 +30,7 @@ mod python_api; #[cfg(feature = "python-support")] pub use python_api::*; -#[cfg(feature = "quickcheck")] +#[cfg(any(feature = "quickcheck", test))] mod quickcheck; #[cfg(feature = "serde")] diff --git a/src/rust_api.rs b/src/rust_api.rs index 44b1472..833419d 100644 --- a/src/rust_api.rs +++ b/src/rust_api.rs @@ -14,6 +14,7 @@ pub use crate::nucleotide::{ pub use crate::trans_table::TranslationTable; use crate::Extendable; +use crate::canonical::Canonical; use crate::expansions::Expansions; use crate::trans_table::reverse_complement; @@ -338,6 +339,16 @@ impl FromStr for DnaSequence { } } +impl DnaSequence { + /// Return canonical isomorphic DNA sequence. + /// + /// See [`Canonical`] for details. + pub fn canonical(&self) -> Self { + let canonical = Canonical::new(self.as_slice().iter().copied()).collect(); + Self::new(canonical) + } +} + impl DnaSequence { /// Return all unambiguous expansions. /// From c6818fb9abfe7c405b9fc9e36ca3887bcb5f0755 Mon Sep 17 00:00:00 2001 From: Steve Wooster Date: Tue, 24 Oct 2023 14:55:56 -0700 Subject: [PATCH 2/3] LexicalMin doc and test improvements --- src/canonical.rs | 17 +++++++++++++++-- 1 file changed, 15 insertions(+), 2 deletions(-) diff --git a/src/canonical.rs b/src/canonical.rs index c364c98..eb925b1 100644 --- a/src/canonical.rs +++ b/src/canonical.rs @@ -117,8 +117,15 @@ where impl> ExactSizeIterator for ForwardCanonical {} -// Like an allocation-free variant of: -// Vec::from_iter(iter1).min(iter2.collect()).into_iter() +// Given two sequences, returns whichever one is lexically less than the other. +// This is like an allocation-free equivalent of: +// Vec::from_iter(iter1).min(iter2.collect()).into_iter() +// For example: +// let x = [2, 1, 3]; +// let y = [2, 2, 2]; +// let lmin = LexicalMin::new(x.iter(), y.iter()); +// assert!(x < y); +// assert!(lmin.eq(x.iter())); // because x < y #[derive(Clone, Debug)] struct LexicalMin { iter1: I1, @@ -417,5 +424,11 @@ mod test { let canonical2 = canonical.canonical(); canonical2 == canonical } + + fn lexical_min_is_equivalent_to_vec_min(vec1: Vec, vec2: Vec) -> bool { + let lmin = LexicalMin::new(vec1.iter(), vec2.iter()); + let vmin = vec1.clone().min(vec2.clone()); + lmin.eq(vmin.iter()) + } } } From deb913ba6a5545269b53d47ad14d96996f974d9c Mon Sep 17 00:00:00 2001 From: Steve Wooster Date: Tue, 24 Oct 2023 15:41:42 -0700 Subject: [PATCH 3/3] Canonical doc and test improvements --- src/canonical.rs | 6 +++++- src/rust_api.rs | 24 ++++++++++++++++++++++++ 2 files changed, 29 insertions(+), 1 deletion(-) diff --git a/src/canonical.rs b/src/canonical.rs index eb925b1..ae1b07d 100644 --- a/src/canonical.rs +++ b/src/canonical.rs @@ -58,7 +58,7 @@ impl ExactSizeIterator for Canonical where /// /// This returns a sequence of [`Nucleotide`]s that is: /// * Isomorphic to the original sequence; that is, the bases can be remapped to convert between -/// the original and forward-canonnical sequences. So `ATA` and `GAG` have the same +/// the original and forward-canonical sequences. So `ATA` and `GAG` have the same /// forward-canonical sequence but `TAA` and `GAG` do not. /// * Lexically "before" all other [`Nucleotide`] sequences that are isomorphic to it. Note that /// (at the time of this writing) the order of [`Nucleotide`]s is @@ -425,6 +425,10 @@ mod test { canonical2 == canonical } + fn canonicalization_is_unaffected_by_reverse_complement(dna: DnaSequenceStrict) -> bool { + dna.canonical() == dna.reverse_complement().canonical() + } + fn lexical_min_is_equivalent_to_vec_min(vec1: Vec, vec2: Vec) -> bool { let lmin = LexicalMin::new(vec1.iter(), vec2.iter()); let vmin = vec1.clone().min(vec2.clone()); diff --git a/src/rust_api.rs b/src/rust_api.rs index 833419d..00fe78f 100644 --- a/src/rust_api.rs +++ b/src/rust_api.rs @@ -342,7 +342,31 @@ impl FromStr for DnaSequence { impl DnaSequence { /// Return canonical isomorphic DNA sequence. /// + /// This returns the lexical minimum of all sequences isomorphic to the original or its + /// reverse. In other words, two sequences have the same canonical sequence if and only if + /// they are isomorphic (or one is isomorphic to the reverse of the other). /// See [`Canonical`] for details. + /// + /// # Caveat + /// + /// We define "lexical minimum" in terms of the ordering of [`Nucleotide`] which is currently + /// [`A`](Nucleotide::A) [`T`](Nucleotide::T) [`C`](Nucleotide::C) [`G`](Nucleotide::G), + /// _not_ alphabetical. + /// + /// # Examples + /// + /// ``` + /// use quickdna::DnaSequenceStrict; + /// + /// let dna: DnaSequenceStrict = "CATTAG".parse().unwrap(); + /// let expected: DnaSequenceStrict = "ATCCTG".parse().unwrap(); + /// assert_eq!(dna.canonical(), expected); + /// + /// let dna: DnaSequenceStrict = "TAGACGTACGTAGTACGTTAGCTGAGCTGAGTACG".parse().unwrap(); + /// // Reverse complement does not change the canonical sequence, + /// // because by definition its reverse is isomorphic to the original. + /// assert_eq!(dna.canonical(), dna.reverse_complement().canonical()); + /// ``` pub fn canonical(&self) -> Self { let canonical = Canonical::new(self.as_slice().iter().copied()).collect(); Self::new(canonical)